Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Equus caballus (horse) microRNA eca-mir-107b precursor secondary structure diagram

Equus caballus (horse) microRNA eca-mir-107b precursor URS000008F0CF_9796

Automated summary: This pre miRNA sequence is 81 nucleotides long and is found in Equus caballus. Annotated by 2 databases (RefSeq, miRBase). Described in 3 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-103, RF00129). Equus caballus (horse) microRNA eca-mir-107b precursor sequence is a product of 107, 107b, mir-107b, MIR107B genes. Found in the horse reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUCUCUGCUUUCAGCUUCUUUACAGUGUUGCCUUGUGGCAUGGAGUUCAAGCAGCAUUGUACAGGGCUAUCAAAGCACAGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 44 other species

    2D structure New