Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Capra hircus (goat) chi-miR-24-3p URS000008BBEA_9925

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGCUCAGUUCAGCAGGAAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Cervus elaphus (red deer) cel-miR-24-3p
  2. Chiloscyllium plagiosum microRNA cpl-miR-24-3p
  3. Daubentonia madagascariensis (aye-aye) dma-miR-24
  4. Gadus morhua (Atlantic cod) gmo-miR-24a-3p
  5. Haplochromis burtoni abu-miR-24a
  6. Ictalurus punctatus (channel catfish) ipu-miR-24b
  7. Maylandia zebra mze-miR-24a
  8. Microcebus murinus mmr-miR-24
  9. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72539
  10. Neolamprologus brichardi (lyretail cichlid) nbr-miR-24c
  11. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-24
  12. Oreochromis niloticus oni-miR-24b-3p
  13. Papio hamadryas (hamadryas baboon) pha-miR-24
  14. Pundamilia nyererei pny-miR-24a-3
  15. Salmo salar ssa-miR-24a-3p
Publications