Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae YJM1527 tRNA-Asn secondary structure diagram

Saccharomyces cerevisiae YJM1527 tRNA-Asn URS0000089FC1_1294383

Automated summary: This tRNA sequence is 74 nucleotides long and is found in Saccharomyces cerevisiae YJM1527. Annotated by 1 database (ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GACUCCAUGGCCAAGUUGGUUAAGGCGUGCGACUGUUAAUCGCAAGAUCGUGAGUUCAACCCUCACUGGGGUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 139 other species

    1. Saccharomyces arboricola H-6 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    2. Saccharomyces boulardii (nom. inval.) tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    3. Saccharomyces cerevisiae AWRI796 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    4. Saccharomyces cerevisiae (baker's yeast) tN(GTT)OL - systematic name
    5. Saccharomyces cerevisiae CBS 7960 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    6. Saccharomyces cerevisiae CEN.PK113-7D tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    7. Saccharomyces cerevisiae CLIB215 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    8. Saccharomyces cerevisiae CLIB324 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 11)
    9. Saccharomyces cerevisiae CLIB382 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 4)
    10. Saccharomyces cerevisiae EC1118 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    11. Saccharomyces cerevisiae EC9-8 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    12. Saccharomyces cerevisiae FL100 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    13. Saccharomyces cerevisiae FostersB tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    14. Saccharomyces cerevisiae FostersO tRNA
    15. Saccharomyces cerevisiae Kyokai no. 7 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    16. Saccharomyces cerevisiae Lalvin QA23 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    17. Saccharomyces cerevisiae P283 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    18. Saccharomyces cerevisiae P301 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    19. Saccharomyces cerevisiae PE-2 tRNA-Asn
    20. Saccharomyces cerevisiae PW5 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
    21. Saccharomyces cerevisiae R008 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    22. Saccharomyces cerevisiae R103 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    23. Saccharomyces cerevisiae RM11-1a tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    24. Saccharomyces cerevisiae S288C Asparagine tRNA (tRNA-Asn), predicted by tRNAscan-SE analysis
    25. Saccharomyces cerevisiae Sigma1278b tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    26. Saccharomyces cerevisiae T73 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 5)
    27. Saccharomyces cerevisiae T7 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    28. Saccharomyces cerevisiae UC5 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    29. Saccharomyces cerevisiae UFMG A-905 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 9)
    30. Saccharomyces cerevisiae Vin13 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    31. Saccharomyces cerevisiae VL3 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    32. Saccharomyces cerevisiae W303 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    33. Saccharomyces cerevisiae Y10 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 6)
    34. Saccharomyces cerevisiae YJM1078 tRNA-Asn
    35. Saccharomyces cerevisiae YJM1083 tRNA-Asn
    36. Saccharomyces cerevisiae YJM1129 tRNA-Asn
    37. Saccharomyces cerevisiae YJM1133 tRNA-Asn
    38. Saccharomyces cerevisiae YJM1190 tRNA-Asn
    39. Saccharomyces cerevisiae YJM1199 tRNA-Asn
    40. Saccharomyces cerevisiae YJM1202 tRNA-Asn
    41. Saccharomyces cerevisiae YJM1208 tRNA-Asn
    42. Saccharomyces cerevisiae YJM1242 tRNA-Asn
    43. Saccharomyces cerevisiae YJM1244 tRNA-Asn
    44. Saccharomyces cerevisiae YJM1248 tRNA-Asn
    45. Saccharomyces cerevisiae YJM1250 tRNA-Asn
    46. Saccharomyces cerevisiae YJM1252 tRNA-Asn
    47. Saccharomyces cerevisiae YJM1273 tRNA-Asn
    48. Saccharomyces cerevisiae YJM1304 tRNA-Asn
    49. Saccharomyces cerevisiae YJM1307 tRNA-Asn
    50. Saccharomyces cerevisiae YJM1311 tRNA-Asn
    51. Saccharomyces cerevisiae YJM1326 tRNA-Asn
    52. Saccharomyces cerevisiae YJM1332 tRNA-Asn
    53. Saccharomyces cerevisiae YJM1336 tRNA-Asn
    54. Saccharomyces cerevisiae YJM1338 tRNA-Asn
    55. Saccharomyces cerevisiae YJM1341 tRNA-Asn
    56. Saccharomyces cerevisiae YJM1342 tRNA-Asn
    57. Saccharomyces cerevisiae YJM1355 tRNA-Asn
    58. Saccharomyces cerevisiae YJM1356 tRNA-Asn
    59. Saccharomyces cerevisiae YJM1381 tRNA-Asn
    60. Saccharomyces cerevisiae YJM1383 tRNA-Asn
    61. Saccharomyces cerevisiae YJM1385 tRNA-Asn
    62. Saccharomyces cerevisiae YJM1386 tRNA-Asn
    63. Saccharomyces cerevisiae YJM1387 tRNA-Asn
    64. Saccharomyces cerevisiae YJM1388 tRNA-Asn
    65. Saccharomyces cerevisiae YJM1389 tRNA-Asn
    66. Saccharomyces cerevisiae YJM1399 tRNA-Asn
    67. Saccharomyces cerevisiae YJM1400 tRNA-Asn
    68. Saccharomyces cerevisiae YJM1401 tRNA-Asn
    69. Saccharomyces cerevisiae YJM1402 tRNA-Asn
    70. Saccharomyces cerevisiae YJM1415 tRNA-Asn
    71. Saccharomyces cerevisiae YJM1417 tRNA-Asn
    72. Saccharomyces cerevisiae YJM1418 tRNA-Asn
    73. Saccharomyces cerevisiae YJM1419 tRNA-Asn
    74. Saccharomyces cerevisiae YJM1433 tRNA-Asn
    75. Saccharomyces cerevisiae YJM1434 tRNA-Asn
    76. Saccharomyces cerevisiae YJM1439 tRNA-Asn
    77. Saccharomyces cerevisiae YJM1443 tRNA-Asn
    78. Saccharomyces cerevisiae YJM1444 tRNA-Asn
    79. Saccharomyces cerevisiae YJM1447 tRNA-Asn
    80. Saccharomyces cerevisiae YJM1450 tRNA-Asn
    81. Saccharomyces cerevisiae YJM1460 tRNA-Asn
    82. Saccharomyces cerevisiae YJM1463 tRNA-Asn
    83. Saccharomyces cerevisiae YJM1477 tRNA-Asn
    84. Saccharomyces cerevisiae YJM1478 tRNA-Asn
    85. Saccharomyces cerevisiae YJM1479 tRNA-Asn
    86. Saccharomyces cerevisiae YJM1526 tRNA-Asn
    87. Saccharomyces cerevisiae YJM1549 tRNA-Asn
    88. Saccharomyces cerevisiae YJM1573 tRNA-Asn
    89. Saccharomyces cerevisiae YJM1574 tRNA-Asn
    90. Saccharomyces cerevisiae YJM1592 tRNA-Asn
    91. Saccharomyces cerevisiae YJM1615 tRNA-Asn
    92. Saccharomyces cerevisiae YJM189 tRNA-Asn
    93. Saccharomyces cerevisiae YJM193 tRNA-Asn
    94. Saccharomyces cerevisiae YJM195 tRNA-Asn
    95. Saccharomyces cerevisiae YJM244 tRNA-Asn
    96. Saccharomyces cerevisiae YJM248 tRNA-Asn
    97. Saccharomyces cerevisiae YJM269 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    98. Saccharomyces cerevisiae YJM270 tRNA-Asn
    99. Saccharomyces cerevisiae YJM271 tRNA-Asn
    100. Saccharomyces cerevisiae YJM320 tRNA-Asn
    101. Saccharomyces cerevisiae YJM326 tRNA-Asn
    102. Saccharomyces cerevisiae YJM428 tRNA-Asn
    103. Saccharomyces cerevisiae YJM450 tRNA-Asn
    104. Saccharomyces cerevisiae YJM451 tRNA-Asn
    105. Saccharomyces cerevisiae YJM453 tRNA-Asn
    106. Saccharomyces cerevisiae YJM456 tRNA-Asn
    107. Saccharomyces cerevisiae YJM470 tRNA-Asn
    108. Saccharomyces cerevisiae YJM541 tRNA-Asn
    109. Saccharomyces cerevisiae YJM554 tRNA-Asn
    110. Saccharomyces cerevisiae YJM555 tRNA-Asn
    111. Saccharomyces cerevisiae YJM627 tRNA-Asn
    112. Saccharomyces cerevisiae YJM681 tRNA-Asn
    113. Saccharomyces cerevisiae YJM682 tRNA-Asn
    114. Saccharomyces cerevisiae YJM683 tRNA-Asn
    115. Saccharomyces cerevisiae YJM689 tRNA-Asn
    116. Saccharomyces cerevisiae YJM693 tRNA-Asn
    117. Saccharomyces cerevisiae YJM969 tRNA-Asn
    118. Saccharomyces cerevisiae YJM972 tRNA-Asn
    119. Saccharomyces cerevisiae YJM975 tRNA-Asn
    120. Saccharomyces cerevisiae YJM978 tRNA-Asn
    121. Saccharomyces cerevisiae YJM981 tRNA-Asn
    122. Saccharomyces cerevisiae YJM984 tRNA-Asn
    123. Saccharomyces cerevisiae YJM987 tRNA-Asn
    124. Saccharomyces cerevisiae YJM990 tRNA-Asn
    125. Saccharomyces cerevisiae YJM993 tRNA-Asn
    126. Saccharomyces cerevisiae YJM996 tRNA-Asn
    127. Saccharomyces cerevisiae YJSH1 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 10)
    128. Saccharomyces eubayanus tRNA-Asn
    129. Saccharomyces kudriavzevii IFO 1802 tRNA-Asn (GTT) (tRNA-Asn-GTT-1 1 to 8)
    130. Saccharomyces pastorianus tRNA-Asn
    2D structure New