Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Saccharomyces cerevisiae FostersO tRNA secondary structure diagram

Saccharomyces cerevisiae FostersO tRNA URS00000841E3_764101

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUGUUUGGCCGAGCGGUCUAAGGCGCCUGAUUCAAGAAAUAUCUUGACCGCAGUUAACUGUGGGAAUACUCAGGUAUCGUAAGAUGCAAGAGUUCGAAUCUCUUAGCAACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 15 other species

  1. Fusarium falciforme tRNA-Leu
  2. Saccharomyces cerevisiae AWRI796 tRNA
  3. Saccharomyces cerevisiae tRNA-Leu3 - common name
  4. Saccharomyces cerevisiae EC1118 tRNA-Leu
  5. Saccharomyces cerevisiae FostersB tRNA
  6. Saccharomyces cerevisiae Lalvin QA23 tRNA
  7. Saccharomyces cerevisiae P301 tRNA-Leu
  8. Saccharomyces cerevisiae R008 tRNA-Leu
  9. Saccharomyces cerevisiae R103 tRNA-Leu
  10. Saccharomyces cerevisiae RM11-1a tRNA-Leu
  11. Saccharomyces cerevisiae S288C tRNA-Leu
  12. Saccharomyces cerevisiae Vin13 tRNA
  13. Saccharomyces cerevisiae VL3 tRNA
  14. Saccharomyces pastorianus tRNA-Leu
  15. Streptomyces coelicolor tRNA-OTHER
2D structure Publications