Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5.8S ribosomal RNA from Candida albicans SC5314 (PDB 7PZY, chain 4) secondary structure diagram

5.8S ribosomal RNA from Candida albicans SC5314 (PDB 7PZY, chain 4) URS0000082EA4_237561

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACUUUCAACAACGGAUCUCUUGGUUCUCGCAUCGAUGAAGAACGCAGCGAAAUGCGAUACGUAAUAUGAAUUGCAGAUAUUCGUGAAUCAUCGAAUCUUUGAACGCACAUUGCGCCCUCUGGUAUUCCGGAGGGCAUGCCUGUUUGAGCGUCGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Candida albicans 5.8S ribosomal RNA from Candida albicans (PDB 8Q5I, chain 4)
  2. Candida africana 5.8S ribosomal RNA
  3. Candida dubliniensis 5.8S ribosomal RNA
  4. uncultured Candida 5.8S ribosomal RNA
2D structure Publications