Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3125 URS0000081D1E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3125: Hsa-mir-3125 is a microRNA that has been found to be negatively regulated with the expression of ACE2 (p <0.05) [PMC8385656]. It is also associated with platelet apoptosis and adhesion in ITP [PMC10048672]. Hsa-mir-3125, along with hsa-mir-890, has been found to target GAP43 [PMC9837191]. In a study on peripheral serum, the expression of hsa-mir-3125 was significantly up-regulated [PMC6493311]. Hsa-mir-3125 is related to cell death, mitochondrion, metabolic process, and protein kinase [PMC4077747]. In a comparison of control groups, hsa-mir-3125 had little differential expression [PMC9537587]. References: [PMC8385656] - Liang Y et al. (2021) Identification of key microRNAs associated with COVID-19 susceptibility and clinical outcome. J Transl Med. 19(1): 19. [PMC10048672] - Li Y et al. (2020) Identification of key microRNAs associated with platelet apoptosis and adhesion in immune thrombocytopenia by small RNA sequencing. J Transl Med. 18(1): 453. [PMC9837191] - Zhang Y et al. (2020) GAP43 3'UTR functions as a ceRNA in the regulation of GAP43 by competing for miR‑890‑3p in glioblastoma cells. Mol Med Rep. 22(2): 1237-1246. [PMC6493311] - Zhang J et al. (2019) Identification of miRNA biomarkers for early diagnosis of acute myocardial infarction by small RNA sequencing data analysis on peripheral serum samples: MiRNA expression profiling for AMI diagnosis. Medicine (Baltimore). 98(16): e15315. [PMC4077747] - Li Y et al. (2014) Identification of miRNA-mRNA modules is an essential step in the construction of miRNA regulatory networks. Mol Med Rep. 10(2): 907-912. [PMC9537587] - Li Y et al. (2021) Identification of key microRNAs and genes in the response to YgiM deletion in Escherichia coli by small RNA sequencing and RNA sequencing analysis. Mol Med Rep. 24(1): 1-10.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGAGGAAGCUGUGGAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications