Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-377-3p URS000007F792_9986

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUCACACAAAGGCAACUUUUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

  1. Bos taurus (cattle) bta-miR-377
  2. Callithrix jacchus cja-miR-377
  3. Canis lupus familiaris (dog) Cfa-Mir-154-P6_3p (mature (guide))
  4. Cavia porcellus cpo-miR-377-3p
  5. Equus caballus eca-miR-377
  6. Homo sapiens hsa-miR-377-3p
  7. Macaca mulatta mml-miR-377-3p
  8. Mus musculus mmu-miR-377-3p
  9. Pan troglodytes (chimpanzee) ptr-miR-377
  10. Pongo pygmaeus ppy-miR-377
  11. Pteropus alecto pal-miR-377-3p
  12. Sus scrofa (pig) ssc-mir31
Publications