Gorilla gorilla (western gorilla) ggo-miR-330

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla (western gorilla) ggo-miR-330 URS000007A060_9593

23 nucleotides
1 database (miRBase)
Found in 10 other species
1 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCAAAGCACACGGCCUGCAGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Bos taurus (cattle) bta-miR-330
Cervus elaphus cel-miR-330
Gorilla gorilla gorilla ggo-miR-330 (MIR330)
Homo sapiens (human) hsa-miR-330-3p
Macaca mulatta (Rhesus monkey) mml-miR-330-3p
Pan troglodytes (chimpanzee) ptr-miR-330
Pongo pygmaeus ppy-miR-330-3p
Pteropus alecto pal-miR-330-3p
Sus scrofa (pig) ssc-mir264
Tupaia chinensis (Chinese tree shrew) tch-miR-330-3p

Publications