Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1180-3p URS0000079D48_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1180: Hsa-mir-1180 is a miRNA that has been identified in various studies and has been found to be both upregulated and downregulated in different contexts. It has been shown to be downregulated in non-small cell lung cancer (NSCLC) and upregulated in small cell lung cancer (SCLC) [PMC8799260]. Hsa-mir-1180 has also been identified as a differentially expressed miRNA in gestational diabetes mellitus (GDM) [PMC4222092]. In addition, hsa-mir-1180 has been found to have a target site motif that includes the KCNJ10:g.22141027insC sequence [PMC5057501]. It is worth noting that hsa-mir-1180 has also been implicated in other diseases, such as sudden sensorineural hearing loss (SSNHL) [PMC5708990]. Furthermore, hsa-mir-1180 has shown potential as a biomarker for distinguishing SCLC from controls [PMC7943919]. In terms of its target genes, hsa-mir-1180 is predicted to regulate various genes, including FOXF2, CREB5, ARID1A, SMAD2, G3BP1, CELF2, TFAP2B, and CLCN5 [PMC4966693]. Overall, hsa-mir-1180 appears to have diverse roles and potential implications in different diseases and contexts.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCCGGCUCGCGUGGGUGUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Macaca mulatta (Rhesus monkey) mml-miR-1180-3p
  2. Pongo pygmaeus ppy-miR-1180
Publications