Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2345 (LINC02345) URS0000077027_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02345: LINC02345 is a long non-coding RNA (lncRNA) that has been identified as one of the eleven ferroptosis-associated prognostic lncRNAs [PMC9338734]. It has also been found to be a differentially expressed lncRNA (DEirlncRNA) that has not been previously reported [PMC8436904]. LINC02345 has been positively correlated with resting dendritic cells, M2 macrophages, and activated memory CD4 T cells [PMC7907456]. In a study, LINC02345 was one of the four promising lncRNAs identified, along with LINC00943, SRD5A3-AS1, and U62317.3 [PMC8751601]. These four lncRNAs were used to develop a prognostic risk model for cancer patients [PMC8751601]. However, SRD5A3-AS1, U62317.3, and LINC02345 have not yet been reported in cancers [PMC8751601].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUUCUUCUGCAGGCAAACGGAGUCGCCAUAUGACCCAGCCCUGGUCUUGCUUGGCUUUCUGGAUGUUCUCAACCUUGACAUGACUCCUUAUUCUCCAAUUCAUUUGGACCUCAAGACACUACUACUCUGGCUACAGCCGCCAGGCAUUAAAAAGAUGACACAGAAAAAUUACAGAGUCAGCAUAUAUUUGAAUACUGGAUAAAAGGGAAGAGGAUGAAAUGGAUUUUUCAAAGCUUCUAAAGAAAACAGAACUAGCUGUGUAGCAGACUCCUCUUAUAAACCUCUGCGAAGUUCUACUUGAAAAGCUGUGGUUUCAUUUCAAAGGAAACCAGCAAUCAGGGGGAUCUCUACAGGAAAAUCUCUUCCCUAUGUCUUCUUUAGACUCUUCAAAAAGGAGAGAGAGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications