v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-29a-5p URS0000076995_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-29a: To investigate the physiological role of cell endogenous hsa-mir-29a on HIV-1 replication, we used LNA modified anti-miR29a to downregulate cellular miR29a in HEK293T cells [PMC2635386]. We next either over-expressed or downregulated hsa-mir-29a and hsa-miR-29b to test the effects of these miRNAs on virus replication [PMC2635386].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUGAUUUCUUUUGGUGUUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Mus musculus (house mouse) mmu-miR-29a-5p
  2. Ornithorhynchus anatinus (platypus) oan-miR-29a-1-5p
  3. Pteropus alecto pal-miR-29a-5p
  4. Rattus norvegicus (Norway rat) rno-miR-29a-5p
  5. Sus scrofa (pig) ssc-miR-29a-5p
 Publications