v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Staphylococcus pseudintermedius HKU10-03 5S ribosomal RNA secondary structure diagram

Staphylococcus pseudintermedius HKU10-03 5S ribosomal RNA URS000007683F_937773

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCUGGUGCCAAUGGCAAAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUUUAGCGCCGAUGGUAGUCGGACUUACGUUCCGCGAGAGUAGGACGGUGCCAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Staphylococcus delphini 5S ribosomal RNA
  2. Staphylococcus felis 5S ribosomal RNA
  3. Staphylococcus intermedius 5S ribosomal RNA
  4. Staphylococcus intermedius NCTC 11048 5S ribosomal RNA
  5. Staphylococcus lutrae 5S ribosomal RNA
  6. Staphylococcus pseudintermedius 5S ribosomal RNA
  7. Staphylococcus pseudintermedius ED99 5S ribosomal RNA
  8. Staphylococcus sp. MI 10-1553 5S ribosomal RNA
 2D structure