Oryzias latipes (Japanese medaka) ola-miR-143 URS00000740D6_8090

• 20 nucleotides
• 2 databases (miRBase, RefSeq)
• Found in 8 other species
• 241 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGAUGAAGCACUGUAGCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

1. Callithrix jacchus cja-miR-143
2. Callorhinchus milii eshark_mir-143_1
3. Cyprinus carpio ccr-miR-143
4. Gadus morhua (Atlantic cod) gmo-miR-143-3p
5. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72404
6. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62954
7. Saimiri boliviensis boliviensis sbo-miR-143
8. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-1697687

Publications Download

• FASTA
• JSON