Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-4298 URS00000726BD_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4298: Hsa-mir-4298 is a microRNA that has been identified in various studies as being dysregulated in different conditions and diseases, including breast cancer, bone diseases, and ocular disorders [PMC4792579] [PMC5887684] [PMC4991404] [PMC4867432] [PMC3521223] [PMC9154092]. It has been found to be downregulated in breast cancer cells and upregulated in bone marrow mesenchymal stem cells (BMSCs) from patients with steroid-induced osteonecrosis of the femoral head (SONFH) compared to femoral neck fracture (FNF) patients [PMC4792579] [PMC5887684]. Additionally, hsa-mir-4298 has been identified as one of the dysregulated miRNAs in MDA-MB-231/Doc cells and their exosomes, MDA-MB-231/Epi cells and their exosomes, and MDA-MB-231/Nvb cells and their exosomes [PMC4991404]. It has also been found to be differentially expressed between leiomyoma and myometrium tissues, with downregulation observed in leiomyoma tissues compared to myometrium tissues [PMC9154092]. Furthermore, hsa-mir-4298 has been identified as a potential diagnostic biomarker for vernal keratoconjunctivitis (VKC) when compared to healthy controls [PMC9039132]. Overall, hsa-mir-4298 is a versatile microRNA that exhibits dysregulation in various diseases and conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CUGGGACAGGAGGAGGAGGCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications