Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR162a URS000006E530_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Described in 1 paper. Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR162a sequence is a product of osa-miR162a, miR162a, miR162 genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCGAUAAACCUCUGCAUCCAG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 42 other species

    1. Acacia auriculiformis aau-miR162
    2. Ananas comosus miR162
    3. Arabidopsis lyrata aly-miR162a-3p
    4. Arabidopsis thaliana (thale cress) ath-miR162a-3p
    5. Brassica rapa (field mustard) bra-miR162-3p
    6. Carica papaya (papaya) cpa-miR162a
    7. Citrus sinensis (sweet orange) csi-miR162-3p
    8. Cucumis melo (muskmelon) cme-miR162
    9. Cynara cardunculus var. scolymus cca-miR162a
    10. Eugenia uniflora eun-miR162-3p
    11. Fragaria vesca subsp. vesca fve-miR162-3p
    12. Glycine max gma-miR162b
    13. Gossypium hirsutum ghr-miR162a
    14. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr04g0109855
    15. Helianthus petiolaris hpe-miR162a
    16. Helianthus tuberosus htu-miR162a
    17. Linum usitatissimum lus-miR162a
    18. Malus domestica mdm-miR162a
    19. Manihot esculenta (cassava) mes-miR162
    20. Medicago truncatula (barrel medic) mtr-miR162
    21. Nicotiana tabacum (common tobacco) nta-miR162a
    22. Oryza sativa (rice) osa-miR162a
    23. Pachycladon cheesemanii Pch-miR162a
    24. Pachycladon fastigiatum Pfa-miR162a
    25. Pinus densata pde-miR162
    26. Populus tomentosa Pto-miR162a
    27. Populus trichocarpa (black cottonwood) ptc-miR162b
    28. Prunus persica (peach) ppe-miR162
    29. Ricinus communis rco-miR162
    30. Solanum lycopersicum sly-miR162
    31. Solanum tuberosum stu-miR162b-3p
    32. Sorghum bicolor (sorghum) sbi-miR162
    33. Theobroma cacao tcc-miR162
    34. Vigna unguiculata (cowpea) vun-miR162
    35. Vitis vinifera (wine grape) vvi-miR162