Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) mitochondrially encoded tRNA-Met (AUA/G) (MT-TM) secondary structure diagram

Homo sapiens (human) mitochondrially encoded tRNA-Met (AUA/G) (MT-TM) URS000006E464_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MT-TM: MT-TM is a mitochondrial gene that was found to be upregulated in a paediatric case, along with GDF15 and several other mitochondrial genes [PMC8803326]. This finding expands our understanding of the phenotypic spectrum of disease related to MT-TM mutations and the impact of pathogenic mt-tRNA gene variants in both paediatric and adult specialities [PMC6617384]. Additionally, CCL2 was found to be downregulated in the same case [PMC8803326]. This information suggests that MT-TM mutations may play a role in disease pathogenesis and highlights the importance of studying mitochondrial genes in various medical fields.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUACCCUUCCCGUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Cloning vector pRS316-1B9 tRNA-Met
  2. Colobus guereza tRNA-Met
  3. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Met
  4. Hylobates lar (common gibbon) transfer RNA-Met
  5. Hylobates muelleri tRNA-Met
  6. Pan paniscus mitochondrially encoded tRNA-Met (AUA/G) (ENSPPAG00000000009.1)
  7. Pan troglodytes tRNA-Met
  8. Pan troglodytes ellioti tRNA-Met
  9. Pan troglodytes schweinfurthii tRNA-Met
  10. Pan troglodytes troglodytes tRNA-Met
  11. Pan troglodytes ellioti tRNA-Met
  12. Pan troglodytes verus tRNA-Met
  13. Piliocolobus badius (western red colobus) tRNA-Met
  14. Plecotus auritus tRNA-Met
  15. Plecotus macrobullaris tRNA-Met
  16. Pongo abelii (Sumatran orangutan) tRNA (ENSPPYG00000020948.1)
  17. Presbytis sp. Pres2 tRNA-Met
  18. Pygathrix nemaeus (Red shanked douc langur) tRNA-Met
  19. Rhinopithecus bieti 1 RL-2012 tRNA-Met
  20. Rhinopithecus bieti 2 RL-2012 tRNA-Met
  21. Rhinopithecus bieti mitochondrially encoded tRNA-Met (AUA/G) (ENSRBIG00000000009.1)
  22. Trachypithecus barbei tRNA-Met
  23. Trachypithecus germaini (Indochinese lutung) tRNA-Met
  24. Trachypithecus hatinhensis tRNA-Met
  25. Trachypithecus laotum (Laotian langur) tRNA-Met
  26. Trachypithecus obscurus tRNA-Met
  27. Trachypithecus phayrei tRNA-Met
  28. Trachypithecus pileatus tRNA-Met
  29. Trachypithecus shortridgei (Shortridge's langur) tRNA-Met
2D structure Publications