Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Azospirillum lipoferum 4B 5S ribosomal RNA secondary structure diagram

Azospirillum lipoferum 4B 5S ribosomal RNA URS0000064CDC_862719

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGGUGGUCAUGGCGAGGUGUCAAACACCCGAUCCCAUCCCGAACUCGGCCGUGAAAAGCCUCCGCGCCAAUGGUACUGCGUCUUAAGACGUGGGAGAGUAGGUCGCCGCCAGGUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Azospirillum lipoferum 5S rRNA
  2. Azospirillum sp. B510 5S rRNA
2D structure