Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) tRNA-Leu (anticodon TAG) 3-1 secondary structure diagram

Homo sapiens (human) tRNA-Leu (anticodon TAG) 3-1 URS000005AEAB_9606

Automated summary: This tRNA sequence is 82 nucleotides long and is found in Homo sapiens. Annotated by 5 databases (GtRNAdb, Rfam, HGNC, ENA, GeneCards). Described in 7 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (tRNA, RF00005). Homo sapiens (human) tRNA-Leu (anticodon TAG) 3-1 sequence is a product of TRL-TAG3-1, tRNA-Leu-TAG-3-1 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGUAGCGUGGCCGAGUGGUCUAAGGCGCUGGAUUUAGGCUCCAGUCAUUUCGAUGGCGUGGGUUCGAAUCCCACCGCUGCCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 149 other species

    1. Acanthisitta chloris tRNA
    2. Ailuropoda melanoleuca tRNA-Leu (TAG) (tRNA-Leu-TAG-4-1)
    3. Alligator mississippiensis tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    4. Alosa alosa tRNA-Leu
    5. Amazona aestiva tRNA
    6. Ameiurus melas tRNA-Leu
    7. Anguilla anguilla tRNA-Leu
    8. Anolis carolinensis tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    9. Astyanax mexicanus tRNA
    10. Balaenoptera acutorostrata scammoni tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    11. Bos taurus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    12. Callipepla squamata tRNA
    13. Callithrix jacchus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    14. Calypte anna tRNA
    15. Camelus ferus tRNA
    16. Carlito syrichta tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    17. Cavia porcellus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    18. Ceratotherium simum simum tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    19. Chelonia mydas tRNA
    20. Chlorocebus sabaeus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    21. Choloepus hoffmanni tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    22. Chrysemys picta bellii tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    23. Colinus virginianus tRNA
    24. Cricetulus griseus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    25. Cuculus canorus tRNA
    26. Danio rerio tRNA-Leu (TAG) (tRNA-Leu-TAG-6-1)
    27. Dasypus novemcinctus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    28. Dipodomys ordii tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    29. Echinops telfairi tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    30. Equus caballus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    31. Erinaceus europaeus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    32. Eschrichtius robustus tRNA-Leu
    33. Felis catus tRNA-Leu (TAG) (tRNA-Leu-TAG-6-1)
    34. Fukomys damarensis tRNA
    35. Gadus morhua tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1, tRNA-Leu-TAG-2-2)
    36. Gallus gallus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    37. Gasterosteus aculeatus tRNA
    38. Gorilla gorilla gorilla tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    39. Heterocephalus glaber tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    40. Hippoglossus stenolepis (Pacific halibut) tRNA-Leu
    41. Ictidomys tridecemlineatus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    42. Lamprotornis superbus tRNA-OTHER
    43. Larimichthys crocea tRNA
    44. Latimeria chalumnae tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1, tRNA-Leu-TAG-2-2)
    45. Lepisosteus oculatus tRNA
    46. Loxodonta africana tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    47. Macaca mulatta tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    48. Marmota monax tRNA.Leu
    49. Megalops atlanticus tRNA-Leu
    50. Meleagris gallopavo tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    51. Mesocricetus auratus tRNA
    52. Microcebus murinus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    53. Monodelphis domestica tRNA-Leu (TAG) (tRNA-Leu-TAG-5-1)
    54. Mus caroli tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    55. Mus musculus castaneus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    56. Mus musculus domesticus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    57. Mus musculus musculus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    58. Mus musculus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    59. Mus pahari tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    60. Mus spretus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    61. Mustela putorius furo tRNA-Leu (TAG) (tRNA-Leu-TAG-4-1)
    62. Myotis brandtii tRNA
    63. Myotis davidii tRNA
    64. Myotis lucifugus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    65. Neotoma lepida tRNA
    66. Nipponia nippon tRNA
    67. Nomascus leucogenys tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    68. Notamacropus eugenii tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    69. Nothobranchius furzeri tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    70. Ochotona princeps tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    71. Ophiophagus hannah tRNA
    72. Oreochromis niloticus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1, tRNA-Leu-TAG-2-2)
    73. Oryctolagus cuniculus tRNA-Leu (TAG) (tRNA-Leu-TAG-4-1)
    74. Oryzias latipes tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1, tRNA-Leu-TAG-1-2)
    75. Otolemur garnettii tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    76. Ovis aries tRNA-Leu (TAG) (tRNA-Leu-TAG-4-1)
    77. Pangasianodon hypophthalmus tRNA-Leu
    78. Pan troglodytes tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    79. Papio anubis tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    80. Patagioenas fasciata monilis tRNA
    81. Perca flavescens tRNA-Leu
    82. Perca fluviatilis tRNA-Leu
    83. Dryobates pubescens tRNA
    84. Podiceps cristatus tRNA
    85. Poecilia formosa tRNA
    86. Pongo abelii tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    87. Procavia capensis tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    88. Pteropus alecto tRNA
    89. Rattus norvegicus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    90. Saimiri boliviensis boliviensis tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    91. Salmo salar tRNA
    92. Sarcophilus harrisii tRNA-Leu (TAG) (tRNA-Leu-TAG-4-1)
    93. Scleropages formosus tRNA
    94. Sorex araneus tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    95. Sus scrofa tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    96. Taeniopygia guttata tRNA-Leu (TAG) (tRNA-Leu-TAG-1-1)
    97. Takifugu rubripes tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    98. Tetraodon nigroviridis tRNA
    99. Trichechus manatus latirostris tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    100. Tupaia chinensis tRNA
    101. Tursiops truncatus tRNA-Leu (TAG) (tRNA-Leu-TAG-3-1)
    102. Vicugna pacos tRNA-Leu (TAG) (tRNA-Leu-TAG-2-1)
    103. Xenopus laevis tRNA
    104. Xenopus tropicalis tRNA-Leu (TAG) (tRNA-Leu-TAG-6-1)
    105. Xiphophorus maculatus tRNA
    2D structure New