Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-495 URS000005A8ED_10116

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (MirGeneDB, miRBase, RefSeq, PSICQUIC). Described in 11 papers. Rattus norvegicus (Norway rat) rno-miR-495 sequence is a product of miR-495, Mir495, rno-miR-495 genes. Found in the norway rat reference genome.

Interactions 9

According to PSICQUIC, Rattus norvegicus (Norway rat) rno-miR-495 interacts with:

Interaction id Participant Synonyms
URS000005A8ED_10116-0 A0A0G2JSQ5 A0A0G2JSQ5
URS000005A8ED_10116-1 B1WBV2 B1WBV2
URS000005A8ED_10116-2 E9PT44 E9PT44
URS000005A8ED_10116-3 P18088 P18088
URS000005A8ED_10116-4 P52631 P52631
URS000005A8ED_10116-5 P62142 P62142
URS000005A8ED_10116-6 Q62901 Q62901
URS000005A8ED_10116-7 Q99MA1 Q99MA1
URS000005A8ED_10116-8 Q99MA1 Q99MA1

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAACAAACAUGGUGCACUUCUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 28 other species

    1. Bos taurus (cattle) bta-miR-495
    2. Callithrix jacchus cja-miR-495
    3. Canis lupus familiaris cfa-miR-495
    4. Capra hircus chi-miR-495-3p
    5. Cavia porcellus (domestic guinea pig) cpo-miR-495-3p
    6. Dasypus novemcinctus (nine-banded armadillo) dno-miR-495-3p
    7. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-154-P19_3p (mature (guide))
    8. Equus caballus (horse) eca-miR-495
    9. Homo sapiens hsa-miR-495-3p
    10. Macaca mulatta mml-miR-495-3p
    11. Mus musculus (house mouse) mmu-miR-495-3p
    12. Oryctolagus cuniculus (rabbit) ocu-miR-495-3p
    13. Ovis aries oar-miR-495-3p
    14. Pan troglodytes (chimpanzee) ptr-miR-495
    15. Pongo pygmaeus ppy-miR-495
    16. Pteropus alecto pal-miR-495-3p
    17. Sus scrofa ssc-mir35