Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Ovis aries (sheep) oar-miR-16b URS0000058609_9940

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

oar-mir-16b: Oar-mir-16b is a microRNA that has been studied in relation to its expression patterns and target genes in sheep. It has been verified by qRT-PCR in different comparisons, such as MF vs. PF and ML vs. PL, along with other cirRNAs and target miRNAs [PMC8300399]. Oar-mir-16b has been found to be correlated with various novel_circRNAs, such as novel_circ_0003833, novel_circ_0005497, novel_circ_0005617, and others [PMC8300399]. Through competitive endogenous RNA network analysis, target miRNA sites for oar-mir-16b have been identified in circRNAs [PMC8300399]. Oar-mir-16b has also been found to be functionally opposite to the target gene SMAD2 in pituitary cells [PMC8947352]. It has been shown that oar-mir-16b can bind to the lncRNA SM2 and SMAD2 3’-untranslated region [PMC8947352]. In pituitary cells, inhibition of oar-mir-16b promotes cell proliferation and inhibits cell apoptosis [PMC8947352]. The lncRNA SM2 acts as a ceRNA for oar-mir-16b by sponging it and regulating the expression of SMAD2 in pituitary cells [PMC8947352]. Additionally, oar-mir-16b promotes apoptosis but inhibits proliferation of pituitary cells [PMC8947352]. The dual-luciferase reporter assay confirms the direct relationship between oar-mir-16b and the lncRNA SM2 or SMAD2 [PMC8947352].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAGCAGCACGUAAAUAUUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

Publications