Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacteroides abscessus 5S ribosomal RNA secondary structure diagram

Mycobacteroides abscessus 5S ribosomal RNA URS0000055F78_36809

Automated summary: This rRNA sequence is 116 nucleotides long and is found in Mycobacteroides abscessus. Annotated by 2 databases (RefSeq, ENA). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CGGCGGCCACAGCGAGAGGGAAACGCCCGGUCCCAUCCCGAACCCGGAAGCUAAGCCUCUCAGCGCCGAUGGUACUGUUCUCGACACGGAACGGAAGAGUAGGACACCGCCGAACA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 51 other species

    1. Mycobacteroides abscessus 1948 5S ribosomal RNA
    2. Mycobacteroides abscessus 21 5S ribosomal RNA
    3. Mycobacteroides abscessus 3A-0119-R 5S ribosomal RNA
    4. Mycobacteroides abscessus 3A-0122-R 5S ribosomal RNA
    5. Mycobacteroides abscessus 3A-0122-S 5S ribosomal RNA
    6. Mycobacteroides abscessus 3A-0731 5S ribosomal RNA
    7. Mycobacteroides abscessus 3A-0810-R 5S ribosomal RNA
    8. Mycobacteroides abscessus 3A-0930-R 5S ribosomal RNA
    9. Mycobacteroides abscessus 3A-0930-S 5S ribosomal RNA
    10. Mycobacteroides abscessus 4S-0116-R 5S ribosomal RNA
    11. Mycobacteroides abscessus 4S-0116-S 5S ribosomal RNA
    12. Mycobacteroides abscessus 4S-0206 5S ribosomal RNA
    13. Mycobacteroides abscessus 4S-0303 5S ribosomal RNA
    14. Mycobacteroides abscessus 4S-0726-RA 5S ribosomal RNA
    15. Mycobacteroides abscessus 4S-0726-RB 5S ribosomal RNA
    16. Mycobacteroides abscessus 5S-0304 5S ribosomal RNA
    17. Mycobacteroides abscessus 5S-0421 5S ribosomal RNA
    18. Mycobacteroides abscessus 5S-0422 5S ribosomal RNA
    19. Mycobacteroides abscessus 5S-0708 5S ribosomal RNA
    20. Mycobacteroides abscessus 5S-0817 5S ribosomal RNA
    21. Mycobacteroides abscessus 5S-0921 5S ribosomal RNA
    22. Mycobacteroides abscessus 5S-1212 5S ribosomal RNA
    23. Mycobacteroides abscessus 6G-0125-R 5S ribosomal RNA
    24. Mycobacteroides abscessus 6G-0125-S 5S ribosomal RNA
    25. Mycobacteroides abscessus 6G-0212 5S ribosomal RNA
    26. Mycobacteroides abscessus 6G-0728-R 5S ribosomal RNA
    27. Mycobacteroides abscessus 6G-0728-S 5S ribosomal RNA
    28. Mycobacteroides abscessus 6G-1108 5S ribosomal RNA
    29. Mycobacteroides abscessus ATCC 19977 5S ribosomal RNA
    30. Mycobacteroides abscessus MAB_030201_1061 5S ribosomal RNA
    31. Mycobacteroides abscessus MAB_030201_1075 5S ribosomal RNA
    32. Mycobacteroides abscessus MAB_082312_2258 5S ribosomal RNA
    33. Mycobacteroides abscessus MAB_082312_2272 5S ribosomal RNA
    34. Mycobacteroides abscessus MAB_091912_2446 5S ribosomal RNA
    35. Mycobacteroides abscessus MAB_091912_2455 5S ribosomal RNA
    36. Mycobacteroides abscessus MAB_110811_1470 5S ribosomal RNA
    37. Mycobacteroides abscessus MAB_110811_2726 5S ribosomal RNA
    38. Mycobacteroides abscessus subsp. bolletii 103 5S ribosomal RNA
    39. Mycobacteroides abscessus subsp. bolletii 1513 5S ribosomal RNA
    40. Mycobacteroides abscessus subsp. bolletii 1S-151-0930 5S ribosomal RNA
    41. Mycobacteroides abscessus subsp. bolletii 1S-152-0914 5S ribosomal RNA
    42. Mycobacteroides abscessus subsp. bolletii 1S-153-0915 5S ribosomal RNA
    43. Mycobacteroides abscessus subsp. bolletii 1S-154-0310 5S ribosomal RNA
    44. Mycobacteroides abscessus subsp. bolletii 2B-0107 5S ribosomal RNA
    45. Mycobacteroides abscessus subsp. bolletii 2B-0307 5S ribosomal RNA
    46. Mycobacteroides abscessus subsp. bolletii 2B-0626 5S ribosomal RNA
    47. Mycobacteroides abscessus subsp. bolletii 2B-0912-R 5S ribosomal RNA
    48. Mycobacteroides abscessus subsp. bolletii 2B-0912-S 5S ribosomal RNA
    49. Mycobacteroides abscessus subsp. bolletii 2B-1231 5S ribosomal RNA
    50. Mycobacteroides abscessus subsp. massiliense 5S ribosomal RNA
    51. Mycobacteroides abscessus subsp. massiliense CCUG 48898 = JCM 15300 5S ribosomal RNA
    52. Mycobacteroides abscessus subsp. massiliense str. GO 06 5S ribosomal RNA
    2D structure New