v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) P3H2 antisense RNA 1 (P3H2-AS1) URS0000052DF4_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

P3H2-AS1: P3H2-AS1 is a prolyl 3-hydroxylase 2 antisense lncRNA that has been found to be differentially expressed between macroscopically preserved and lesioned osteoarthritis (OA) cartilage [PMC9258540]. It has been shown to regulate the expression of its sense gene, prolyl 3-hydroxylase 2 (P3H2), in cis [PMC9258540]. The lncRNA P3H2-AS1 has been identified as a potential preclinical target for OA treatment through its regulation of P3H2 [PMC8635257]. In a study, primary chondrocytes were transfected with locked nucleic acid (LNA) GapmeRs targeting P3H2-AS1, and the expression level of P3H2 was determined [PMC9793335]. The cis-regulation mechanism of lncRNAs was validated using P3H2-AS1 as an example [PMC9793335]. Another study reported the differential expression of lncRNAs in OA cartilage, including the antisense lncRNA P3H2-AS1, which was found to regulate collagen chain assembly in lesioned OA cartilage through the regulation of P3H2 expression [PMC9593085]. Furthermore, lower expression levels of P3H2-AS1, HOXC-AS1, and HS1BP3-IT1 were associated with longer overall survival rates in patients [PMC8806432]. These findings highlight the potential role of P3H2-AS1 in OA pathophysiology and its potential as a therapeutic target for treatment.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGACUCCGAGAGCCGCUCUCCCAGGCUCCCCGCUGCAGCGGCGGGGCUGCCAGGGGCGGCACACUCCAGCGCCAGCCAGAGAGCUAGCGCCGCUUGAGGCCGGCCGGGGACGAGGCGCUUUACACUGCCUGAUGGGUACUAGCAGCCCACCCCAGCCAGAUGGAGGACAAGGCCUCUCCAAGUCUCAAGGAAAUGCACAAUCCUUCCUUACCUCUGGCCUCAGAACUCUCAGCAUCUCAUUGAUUAGCAACCUCAUCUGUGGCAAAUCUAAGGAACACCUUCUACUUAAAAUUGAAGUCUUCUGGGCUGGGUGUGGUGGCUCAUUCCUGUAAUCCCAGCACUUUGGGAGGCCAAGGAGUGCGGAUCACGAAGUCAGGAGUUCGAGACCAGCCUGGCCAACAUAGUGGAACCCUGUCUCUACUAAAAAUACAAAAAUUAGCCGGGUGUGGUGGCACAUGCCUGUAGUCCCAGCUACUCGGGAGGCUGAGGCCUCUGAGCCCAAGCUAAGCCAUCAUAUCCCCUGUGACCUGCACGUACACAUCCAGAUGGCCGGUUCCUGCCUUAACUGAUGACAUUCCACCACAAAAGAAGUGAAAAUGGUCUGUUCCUGCCUUAACUGAUGACAUUGUCUUGUGAAAUUCCUUCUCCUGGCUCAUCCUGGCUCAAAAGCUCCCCCACUGAGUACCUUGUGAUCCCCACUCCUGCCCACCAGAAAACAACCCCCUUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications