Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bombyx mori (domestic silkworm) bmo-miR-10-5p URS0000051B62_7091

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Bombyx mori. Annotated by 3 databases (RefSeq, miRBase, ENA). Described in 8 papers. Bombyx mori (domestic silkworm) bmo-miR-10-5p sequence is a product of bmo-miR-10-5p, Mir10, miR-10, miR-10-5p, bmo-miR-10 genes. Found in the domestic silkworm reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCCUGUAGAUCCGAAUUUGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 19 other species

    1. Acyrthosiphon pisum api-miR-10
    2. Anopheles gambiae (African malaria mosquito) aga-miR-10
    3. Apis mellifera ame-miR-10-5p
    4. Drosophila ananassae dan-miR-10
    5. Drosophila erecta der-miR-10
    6. Drosophila grimshawi dgr-miR-10
    7. Drosophila melanogaster (fruit fly) miR-10
    8. Drosophila mojavensis dmo-miR-10
    9. Drosophila persimilis dpe-miR-10
    10. Drosophila pseudoobscura dps-miR-10
    11. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294400_df_nrg
    12. Drosophila sechellia dse-miR-10
    13. Drosophila simulans dsi-miR-10
    14. Drosophila willistoni dwi-miR-10
    15. Drosophila yakuba dya-miR-10
    16. Mus musculus Mus_musculus piRNA piR-mmu-8092118
    17. Nasonia longicornis nlo-miR-10
    18. Nasonia vitripennis (jewel wasp) nvi-miR-10
    19. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3376139