Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) testis expressed transcript, Y-linked 21 (TTTY21, TTTY21B) URS000004F3C6_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

TTTY21: TTTY21 is a non-protein coding transcript that has been found to be up-regulated in samples from infertile patients [PMC9444127]. In addition to TTTY21, several other coding and non-coding genes, such as AMELY, PCDH11, SRY, TGIF2LY, TSPY3, and USP9Y, also displayed low expression in samples from fertile patients and high expression in samples from infertile patients [PMC6375207]. Interestingly, a common bimodal pattern of expression was observed for six coding genes (AMELY, PCDH11, SRY, TGIF2LY, TSPY3, and USP9Y) and ten non-coding genes (TTTY2, TTTY4C,TTTY5,TTTY6,TTTY8,TTTY10,TTTY14,TTTY21,TTTY22,andTTTY23), with low expression in fertile patients and high expression associated with infertility [PMC6375207]. Furthermore,KDM5D was found to be over-expressed in males compared to females [PMC3431816]. On the other hand,XIST,KDM5D,andLOC729444 were over-expressed in males compared to females while TTTY21 was under-expressed in females compared to males [PMC3431816]. In summary,the up-regulation of TTTY21 has been observed in infertile patients while it is under-expressed in females compared to males [PMC9444127][PMC3431816][PMC6375207].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAGGCUGCCUGAGAUAACCCACUGCCUUACCCAAAAGGUCUAGACUCUAGAGCCCUUUUGGGCAGUCUCCAUGGUCAGGUCCAACUGAAAGAGGAGUCAUUUUGAGACUGUGAGGUGGUCGCUGCAAUCUGCUCCUCUGUCUCCAUUCCAAAAAGAGACUGUGUGUAAGAGUCUGCUCUCUUGGGGAUUGGAAUACCAUCUGGUGGAGGUUAUUUGGAUGCUGAAACAUUUUGGCAUGCUUCCCAAUCCACUGCAGACUCAUGAAUGAUUCACAGAAAAAUAAAGAACACUGAGCAAUACAGCCCAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Expression New Publications