Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 52 (LINC00052) URS000004E371_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00052: LINC00052 is a long non-coding RNA (lncRNA) that has been implicated in breast cancer (BC) progression. It has been suggested that LINC00052 may promote cell proliferation and metastasis in BC by regulating TGFBR2 [PMC7988718]. The correlation between LINC00052 and HER3 expression has also been investigated, and breast cancer cells expressing ectopic HER3 were used to confirm this relationship [PMC5351650]. Additionally, LINC00052 has been found to influence β-catenin methylation, with its silencing inhibiting β-catenin methylation and its overexpression promoting it [PMC7841087]. Furthermore, in vitro experiments have shown that overexpression of LINC00052 leads to downregulation of IGF2 [PMC8798243]. However, the mechanisms by which LINC00052 upregulates EPB41L3 to inhibit tumor cell migration and invasion are still not fully understood [PMC5609956].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUCAGCUCUCUCACCAUGCGAUUGCCCUGCAACACCUUGGAACUCUGCAGAGAGUCCCCAGCAGGAAGGUCUCACCUGAGGUGAACCUUCGACCUUGGACUUCUCAGCCUCCAGAAUGAAGAAUGGCAACCAUCAAAUCAAGAAAUUGGCCCAAAGCCCUACAGUCUGCAAACAUCAUAACAAUUCAUCCUGAAGUUUCUCCAUGAAUUGUGAUGCUUUGCUACAUCAUUCUGCAAUCCCAGAAGAUUUUUUGCAUAUUUUUUUGCUAUUACAGAAAAAUCUCAGUCUCCCUCCCUCUCUCUCUCUCUCAAUCUGUGUGUCUCUUUUACUCCAUAUCUCUGUGUGUGUCUCUUUUACUCCAUAUCUCUCUGUGUGUGUCUGUUUAUGUCUCUCUCUCUCUCUCAUCCUUCCCAUGUUUCUCUCUCACACACACACACACUCAUUCACAGCUUUCAAAAGACACGUCUGUCCUUACCUUCACUUUUUGUUUUAAACAGCACACUCACUUUACUCUGAACUAUACCUCACAUGCACACGAGCUUUCUGCUCCAUCUGUUCAUCCCACAUGUGUCUUCACAUUCAAAGCAGCACCUUCCCCAAGACCAGCUACCUAACCACCUCCCACCUCCACCCCAUCCCUAGUCAGAGGAAGGCCUGGUUCCCACCUGAAUUCAGCUUUGUCAAAGAGCCUCCUGGAAAGCUGUCAUCUUCAGUUAGUAGGGAUAAUGGGAUUAUUCUAUCUGUGUAAUAAUAACAUGUUCAAUUUAAAGAAAAAAAUCUGAAGCCACUUAAAAGCUACUGUUUGGCACCGAUACAUUAUUCCAGUAAUGAAUAAUCAUUAAAGAUAUUAUUCUGGAUGCAGUUACCAUGCAGUGAUGUGAAUAAAAUGCAUUAGAUGGAAAAUUGUAUUUCAAGUAAAUAUAUGCACUGGUAGAAAUGUAUUACCACCCACUAAUAUGUAUUAAUUCAAAACCAAAUGCCAACUGGAGUUCGCCUACACGGGUUUGAAUGGCAGGCAGUGAUUUGGAAGUGGGAGGAAAUAGGUUUGGAUUUGGUCAAAUAGACUGAGAAGUGAUAGUGGGGGCGGGGGUUUAUGACUCAAACUUUAACAGGUGAGAAGACUAUGCCAUGGACAGAACAGGCAUGAGGGGCUCCCCUCCUACGCCUCUUUAAGAGAUUUUUAUCUCUGACUAAGGAUUACUGGUAGUUGUUGACAUUUCUGAAGCAGUGGAUCUUUUUCCUUUUUCACUAUCUGCAUCUUCAAAUAUUCUUUUCUGAAGAAAGUUAAAAGGAAGCCUGUACAUUUUUUGCUAAGGUAAAUGCCUUGCCAUCUUAUUUCAUUUUCUCAUUUUUUUCUUCAGUGCACAACAUAAGCAACUGUCCUCCUUGUCAUACUCAAGAUGAGCUUGGCAUAUCUGAAAUCUGCAGGGAUUUUCUCAUUAGCACAGGGUUCCAAGCCCAAACCGUGAAGAUGGAGUUUUCAUUUUUAAAUGGCACAUCUUCAAGUUCUUGCCCUGUCCUCACUUUAGUAUGCCCCAGAGGAAGUCAAAGAUAUGGACACUCUAAGACUCAGAAGAACUUUCUCAGGCAUUCAUUUUCCUAUCUAUUUUGAGCCAUUUUAUUUAAAAGGUUACAAUUUUAAACCUCUCUUUAAUUAAAAGAUACCAGAGUUACAAUGCAAUACUAUUUGGCAAUCAAAACUAAUGAAGCACAGAUGCAUGCUACAACACGAAUGAACUUUGAAACGUUGUGUUAAGUGAAAUAAACCAGUUAUUAUACAAGGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications