Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Apis mellifera (honey bee) ame-miR-2796-3p URS000004B10C_7460

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Apis mellifera. Annotated by 4 databases (RefSeq, Ensembl Metazoa, miRBase, ENA). Described in 7 papers. Apis mellifera (honey bee) ame-miR-2796-3p sequence is a product of GeneID_100629039, miR-2796, Mir2796, ame-miR-2796 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUAGGCCGGCGGAAACUACUUGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 9 other species

    1. Aedes aegypti (yellow fever mosquito) Aae-Mir-2796_3p (mature (guide))
    2. Anopheles gambiae (African malaria mosquito) aga-miR-2796-3p
    3. Blattella germanica Bge-Mir-2796_3p (mature (guide))
    4. Bombyx mori (domestic silkworm) bmo-miR-2796-3p
    5. Dinoponera quadriceps dqu-miR-2796-3p
    6. Heliconius melpomene hme-miR-2796
    7. Manduca sexta (tobacco hornworm) mse-miR-2796
    8. Polistes canadensis pca-miR-2796-3p
    9. Tribolium castaneum tca-miR-2796-3p