Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
5S ribosomal RNA from Escherichia coli DH1 (PDB 4V6M, chain B7) secondary structure diagram

5S ribosomal RNA from Escherichia coli DH1 (PDB 4V6M, chain B7) URS0000049E57_536056

Automated summary: This rRNA sequence is 120 nucleotides long and is found in Escherichia coli DH1. Annotated by 1 database (PDBe). Described in 1 paper. Has a conserved secondary structure or a structured region. Has an experimentally determined 3D structure. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 56 other species

    1. Escherichia coli BL21(DE3) 5S ribosomal RNA from Escherichia coli BL21(DE3) (PDB 6QDW, chain a)
    2. Escherichia coli K-12 5S ribosomal RNA from Escherichia coli K-12 (PDB 6TBV, chain 05S1)
    3. Escherichia coli str. K-12 substr. MDS42 5S ribosomal RNA from Escherichia coli str. K-12 substr. MDS42 (PDB 4WOI, chain BB)
    4. Cedecea davisae 5S rRNA
    5. Escherichia coli 55989 ribosomal RNA 5S
    6. Escherichia coli 5S rRNA
    7. Escherichia coli B7A 5S ribosomal RNA
    8. Escherichia coli B str. REL606 5S ribosomal RNA
    9. Escherichia coli BW25113 5S ribosomal RNA of rrnD operon
    10. Escherichia coli BW2952 5S ribosomal RNA of rrnD operon
    11. Escherichia coli CE516 5S ribosomal RNA
    12. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 5S ribosomal RNA
    13. Escherichia coli EC4100B 5S ribosomal RNA
    14. Escherichia coli ER2796 5S ribosomal RNA of rrnD operon
    15. Escherichia coli IAI1 ribosomal RNA 5S
    16. Escherichia coli IHE3034 5S ribosomal RNA
    17. Escherichia coli IS1 5S RNA
    18. Escherichia coli IS25 5S RNA
    19. Escherichia coli IS35 5S RNA
    20. Escherichia coli IS5 5S RNA
    21. Escherichia coli IS9 5S RNA
    22. Escherichia coli ISC41 5S RNA
    23. Escherichia coli ISC7 5S RNA
    24. Escherichia coli O103:H2 str. 12009 5S ribosomal RNA
    25. Escherichia coli O111:H- str. 11128 5S ribosomal RNA
    26. Escherichia coli O145:H28 5S ribosomal RNA
    27. Escherichia coli O145:H28 str. RM12761 5S ribosomal RNA
    28. Escherichia coli O145:H28 str. RM13516 5S ribosomal RNA
    29. Escherichia coli O25b:H4 5S ribosomal RNA
    30. Escherichia coli O26:H11 str. 11368 5S ribosomal RNA
    31. Escherichia coli O5:K4(L):H4 str. ATCC 23502 5S RNA
    32. Escherichia coli S88 ribosomal RNA 5S
    33. Escherichia coli SE11 5S ribosomal RNA
    34. Escherichia coli SE15 5S ribosomal RNA
    35. Escherichia coli str. K-12 substr. DH10B 5S ribosomal RNA
    36. Escherichia coli str. K-12 substr. MC4100 5S ribosomal RNA of rrnD operon
    37. Escherichia coli str. K-12 substr. MG1655 5S ribosomal RNA
    38. Escherichia coli str. K-12 substr. W3110 5S rRNA
    39. Escherichia coli UMN026 ribosomal RNA 5S
    40. Escherichia coli UTI89 5S ribosomal RNA
    41. Escherichia coli VR50 5S ribosomal RNA
    42. Klebsiella pneumoniae IS22 5S RNA
    43. Salmonella enterica 5S rRNA
    44. Salmonella enterica subsp. enterica serovar Cerro 5S ribosomal RNA
    45. Salmonella enterica subsp. enterica serovar Derby ribosomal RNA
    46. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 5S ribosomal RNA
    47. Salmonella enterica subsp. enterica serovar Infantis 5S RNA
    48. Salmonella enterica subsp. enterica serovar Typhimurium 5S ribosomal RNA
    49. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 5S ribosomal RNA
    50. Salmonella enterica subsp. enterica serovar Virchow 5S ribosomal RNA
    51. Shigella boydii ATCC 9905 5S ribosomal RNA
    52. Shigella dysenteriae 1617 5S ribosomal RNA
    53. Shigella dysenteriae 5S rRNA
    54. Shigella dysenteriae CDC 74-1112 5S ribosomal RNA
    55. Shigella flexneri CDC 796-83 5S ribosomal RNA
    56. Shigella sonnei 5S ribosomal RNA
    57. synthetic Escherichia coli C321.deltaA 5S ribosomal RNA
    2D structure New