Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) lncRNA associated with lymph node metastasis in cervical cancer (LNMICC) URS00000487A7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LNMICC: The long noncoding RNA (lncRNA) LNMICC has been shown to promote nodal metastasis in cervical cancer by reprogramming fatty acid metabolism [PMC8529012]. Silencing LNMICC has been found to decrease intracellular triglycerides and phospholipids by influencing the expression of fatty acid metabolic enzymes [PMC8529012]. LNMICC activates fatty acid metabolism by upregulating key enzymes such as FASN, ACC1, ACOX1, CPT1α, and FABP5, leading to increased intracellular triglycerides and phospholipids [PMC8525007]. LNMICC is increased in cervical cancer with lymph metastasis and poor prognosis [PMC8525007]. It has been observed that LNMICC promotes lymph metastasis in cervical cancer through reprogramming fatty acid metabolism and that HSDL2 may be a key factor in lipid metabolism regulation [PMC8107089]. LNMICC promotes tumor growth, cell proliferation, and lymph node metastasis by recruiting NPM1 to the promoter of FABP5 [PMC10088509]. FABP5-mediated fatty acid metabolism promotes lymphangiogenesis in the lymph node pre-metastatic niche through LNMICC [PMC8254237]. LNMICC is characterized as an lncRNA that promotes metastasis in cervical cancer through the reprogramming of fatty acid metabolism [PMC9040090]. It recruits NPM1 to the promoter of FABP5 to reprogram fatty acid metabolism and promote cervical cancer cell metastasis to lymph nodes through EMT and VEGF-C-mediated lymphangiogenesis [PMC8082854]. The lncRNA-LNMICC is a valuable prognostic predictor of cervical cancer with a significant relationship with BMI in patients [PMC8579446]. The pro-tumoral effect of LNMICC can be counteracted by miR-190 re-expression [PMC7599548]. LNMICC regulates key genes involved in fatty acid metabolism, including FASN, CPT1A, ACOX1, and ACC1 [PMC6901916]. LNMICC facilitates fatty acid metabolism reprogramming and promotes lymph node metastasis in cervical cancer cells by regulating FABP5 [PMC6901916]. LNMICC promotes lymph node metastasis via FABP5-mediated fatty acid metabolism and EMT in cervical cancer [PMC7059688]. LNMICC accelerates metastasis by reprogramming fatty acid metabolism in cervical cancer [PMC6708160]. It correlates with lymph node metastasis, EMT, and lymphangiogenesis in cervical cancer [PMC7053319]. LNMICC recruits NPM1 to the promoter of FABP5 to enhance fatty acid metabolism [PMC7053319].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUGCGGCGCCCCGGCCCGGCAGUGCCAGCAGCAGGUCGGCACCGCCAGCGCCACGCUUCUCGGGGGCCCUGGUGUUCCAUGGGGUACCAAUCCAAAGGGUUCGGCUCAACUGGGUACGCGACGGCCUCUCGGGCGCCUCCUGCAAGCAGGGACUCGCCCGGCGCGCCCCACGCCUCAUGGACGCCGGCGCCUGCACGUUUCGGCGCCUCUGCAGGCCCAGGAAGCCAGAGGGGUCACCUGGAGGCCUGGCCCCGCCUCUCCUGCACCCCUCCGUUUGACAACAUAUCCACCGCCGUUUUUCCUUUCAAAAUACCCGGACCAAUCGAUUAGCCCUCGCCGGACUCGGACUGCAGGAAGUGAUUGAUCGGCUGUUUGGUUUAUUGAUUCAUUAACUACGGUGCCUCCCUGACCUUCUGCUCCUCGCCAGCGCACAAGCUCACAAUCCACACCCUCCUAAGAGAACCUGCUCUCGCCAUCCGCAGGUCUCCCUGGCCCAAUAGUGGGGAUAUACCUGAGUUGAGCUAGAGGAUUUUAUCCCUGUUGGGAUGGGGGACGUCUCGGGAAGUGUGGUUUCUAAACUAAAAGACUGCAGGAAGUGUCAACUUUAGUGACUGUCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications