Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Populus tomentosa Pto-miR403b URS0000047B71_118781

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Populus tomentosa. Annotated by 1 database (ENA). Described in 1 paper. Populus tomentosa Pto-miR403b sequence is a product of Pto-miR403b, miR403b, miR403 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UUAGAUUCACGCACAAACUCG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 24 other species

    1. Arabidopsis lyrata aly-miR403a-3p
    2. Arabidopsis thaliana (thale cress) ath-miR403-3p
    3. Brassica napus bna-miR403
    4. Brassica rapa (field mustard) bra-miR403-3p
    5. Citrus sinensis (sweet orange) csi-miR403b-3p
    6. Corchorus capsularis sRNA CCACVL1_22106
    7. Corchorus olitorius aly-miR403-
    8. Cynara cardunculus var. scolymus cca-miR403
    9. Helianthus annuus (common sunflower) sRNA HannXRQ_Chr11g0335175
    10. Helianthus argophyllus har-miR403a
    11. Helianthus petiolaris hpe-miR403a
    12. Helianthus tuberosus htu-miR403b
    13. Malus domestica mdm-miR403a
    14. Manihot esculenta (cassava) mes-miR403a
    15. Nicotiana attenuata microRNA mir-403-like
    16. Populus trichocarpa (black cottonwood) ptc-miR403b
    17. Prunus persica (peach) ppe-miR403
    18. Ricinus communis rco-miR403a
    19. Theobroma cacao tcc-miR403b
    20. Vitis vinifera (wine grape) vvi-miR403f