v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) RNA component of signal recognition particle 7SL1 (RN7SL1) secondary structure diagram

Homo sapiens (human) RNA component of signal recognition particle 7SL1 (RN7SL1) URS00000478B7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

RN7SL1: RN7SL1 is a type of RNA that is expressed in breast cancer cells and is found in stromal exosomes [PMC8885989]. When stromal NOTCH-MYC is triggered in breast cancer cells, it leads to an increase in POL3-driven RN7SL1 expression [PMC8885989]. RN7SL1 has been found to promote expansion and effector-memory differentiation of CAR-T cells, restrict MDSC development, decrease TGFβ in myeloid cells, and foster DC subsets with costimulatory features [PMC10063857]. Exosomes derived from breast cancer stromal fibroblasts carry RN7SL1 that activates RIG-I in tumor cells, resulting in STAT1 activation and ISG induction [PMC7109106]. The expression of RN7SL1 was measured using the ΔΔCt method with normalization to a control primer pair specific to either MDM2 or RN7SL1 [PMC5829647]. DEG analysis showed significant enrichment of RN7SL1 within midpoint samples relative to baseline [PMC9320801].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCGGGCGCGGUGGCGCGUGCCUGUAGUCCCAGCUACUCGGGAGGCUGAGGCUGGAGGAUCGCUUGAGUCCAGGAGUUCUGGGCUGUAGUGCGCUAUGCCGAUCGGGUGUCCGCACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGGGAUCGCGCCUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCGAGACCCCGUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications