v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan paniscus (bonobo) Metazoan signal recognition particle RNA (ENSPPAG00000011924.1, ENSPPAG00000012242.1) secondary structure diagram

Pan paniscus (bonobo) Metazoan signal recognition particle RNA (ENSPPAG00000011924.1, ENSPPAG00000012242.1) URS00000478B7_9597

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCCGGGCGCGGUGGCGCGUGCCUGUAGUCCCAGCUACUCGGGAGGCUGAGGCUGGAGGAUCGCUUGAGUCCAGGAGUUCUGGGCUGUAGUGCGCUAUGCCGAUCGGGUGUCCGCACUAAGUUCGGCAUCAAUAUGGUGACCUCCCGGGAGCGGGGGACCACCAGGUUGCCUAAGGAGGGGUGAACCGGCCCAGGUCGGAAACGGAGCAGGUCAAAACUCCCGUGCUGAUCAGUAGUGGGAUCGCGCCUGUGAAUAGCCACUGCACUCCAGCCUGGGCAACAUAGCGAGACCCCGUCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Gorilla gorilla gorilla (Western Lowland Gorilla) Metazoan signal recognition particle RNA (ENSGGOG00000041960.1)
  2. Homo sapiens RNA component of signal recognition particle 7SL1 (RN7SL1)
  3. Pan troglodytes misc RNA
  4. Pongo abelii misc RNA
 2D structure Publications