Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Drosophila virilis dvi-miR-13b-3p URS000004764F_7244

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Drosophila virilis. Annotated by 2 databases (miRBase, Ensembl Metazoa). Described in 1 paper. Drosophila virilis dvi-miR-13b-3p sequence is a product of FBtr0297143_df_nrg, FBtr0297129_df_nrg genes. Found in the Drosophila virilis reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UAUCACAGCCAUUUUGACGAGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Anopheles gambiae (African malaria mosquito) aga-miR-13b
    2. Culex quinquefasciatus (southern house mosquito) cqu-miR-13
    3. Drosophila ananassae dan-miR-13b
    4. Drosophila erecta der-miR-13b
    5. Drosophila grimshawi dgr-miR-13b
    6. Drosophila melanogaster (fruit fly) dme-miR-13b-3p
    7. Drosophila mojavensis dmo-miR-13b
    8. Drosophila persimilis dpe-miR-13b
    9. Drosophila pseudoobscura dps-miR-13b
    10. Drosophila pseudoobscura pseudoobscura miRNA FBtr0294395_df_nrg
    11. Drosophila sechellia dse-miR-13b
    12. Drosophila simulans dsi-miR-13b
    13. Drosophila willistoni dwi-miR-13b
    14. Drosophila yakuba dya-miR-13b
    15. Tribolium castaneum tca-miR-13b-3p