Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-211-3p URS0000044FD7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-211: Hsa-mir-211 is one of the eight miRNAs (hsa-miR-26a, hsa-miR-26b, hsa-miR-199-5p, hsa-miR-190, hsa-miR-204, hsa-mir-211, hsa-miR-218 and hsa-miR-369-3p) that were selected in a study [PMC5520514]. The study aimed to identify miRNAs that may play a role in melanoma progression and metastasis. Hsa-mir-211 is a microRNA (miRNA) that regulates gene expression by binding to the messenger RNA (mRNA) of target genes [PMC5520514]. The study found that among the selected miRNAs, hsa-mir-211 was one of the potential regulators in melanoma progression and metastasis [PMC5520514]. However, it was found that another miRNA called hsa-miR181b had the most potential target genes and had a significant influence on melanoma progression and metastasis [PMC8728391]. Hsa-mir181b is also an miRNA that regulates gene expression by binding to mRNA [PMC8728391]. The study suggests that both hsa-mir211 and hsa-mir181b may play important roles in melanoma progression and metastasis. However, further research is needed to fully understand their mechanisms of action and potential therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGGGACAGCAAAGGGGUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Oryctolagus cuniculus (rabbit) ocu-miR-211-3p
  2. Pteropus alecto (black flying fox) pal-miR-211-3p
Publications