Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bordetella pertussis CS 5S ribosomal RNA secondary structure diagram

Bordetella pertussis CS 5S ribosomal RNA URS000004240C_1017264

Automated summary: This rRNA sequence is 115 nucleotides long and is found in Bordetella pertussis CS. Annotated by 2 databases (RefSeq, ENA). Described in 2 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GCCUGACGACCAUAGCAAGGUGGUCCCACUCCUUCCCAUCCCGAACAGGACAGUGAAACGCCUUCGCGCCGAUGAUAGUGGAUGUACAUCUGUGAAAGUAGGUCAUCGUCAGGCU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 10 other species

    1. Bordetella bronchiseptica 1289 ribosomal RNA
    2. Bordetella bronchiseptica 253 ribosomal RNA
    3. Bordetella bronchiseptica 5S rRNA
    4. Bordetella bronchiseptica Bbr77 ribosomal RNA
    5. Bordetella bronchiseptica MO149 ribosomal RNA
    6. Bordetella parapertussis 5S rRNA
    7. Bordetella pertussis 137 5S ribosomal RNA
    8. Bordetella pertussis 18323 ribosomal RNA
    9. Bordetella pertussis 5S rRNA
    10. Bordetella pertussis B1917 5S ribosomal RNA
    11. Bordetella pertussis B1920 5S ribosomal RNA
    2D structure New