Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-944 URS000004203C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-944: Hsa-mir-944 is a microRNA that has been implicated in the progression of various cancers [PMC8709995]. In a recent study, it was found that circBACH2 acts as a sponge for hsa-mir-944, leading to the up-regulation of HNRNPC, an m6A RNA methylation modulator [PMC8709995]. This up-regulation of HNRNPC was found to accelerate the progression of breast cancer (BC) [PMC8709995]. This suggests that hsa-mir-944 plays a role in promoting BC progression through its interaction with circBACH2 and HNRNPC [PMC8709995]. Interestingly, it has been hypothesized that hsa-mir-944 may have an inhibitory effect on the progression of gastric cancer (GC) [PMC8460735]. The exact mechanism by which hsa-mir-944 may exert this inhibitory effect is not mentioned in the given context [PMC8460735]. However, this hypothesis suggests that hsa-mir-944 may have different roles in different types of cancer [PMC8460735]. In conclusion, hsa-mir-944 is a microRNA that has been implicated in cancer progression [PMC8709995]. In breast cancer, it interacts with circBACH2 and HNRNPC to accelerate disease progression [PMC8709995]. However, its role in gastric cancer is hypothesized to be inhibitory [PMC8460735]. Further research is needed to fully understand the mechanisms by which hsa-mir-944 influences cancer progression and its potential as a therapeutic target [PMC8709995][PMC8460735].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAAUUAUUGUACAUCGGAUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Pan troglodytes ptr-miR-944
Publications