v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Marinomonas posidonica IVIA-Po-181 5S ribosomal RNA secondary structure diagram

Marinomonas posidonica IVIA-Po-181 5S ribosomal RNA URS0000040119_491952

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUUGACGAUCAUAGAGGCGUUGAACCACCUGAUCCCAUCCCGAACUCAGAAGUGAAAAGCGCCAUCGCCGAUGGUAGUGUGGGGGAUCCCAUGUGAGAGUAGGUCGUCGUCAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Marinomonas algarum 5S ribosomal RNA
  2. Marinomonas posidonica 5S rRNA
  3. Marinomonas sargassi 5S ribosomal RNA
  4. Marinomonas sp. 5S ribosomal RNA
 2D structure Publications