Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) rno-miR-339-5p URS000003FD55_10116

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Rattus norvegicus. Annotated by 4 databases (MirGeneDB, miRBase, RefSeq, PSICQUIC). Described in 11 papers. Rattus norvegicus (Norway rat) rno-miR-339-5p sequence is a product of rno-miR-339, Mir339, rno-miR-339-5p, miR-339, miR-339-5p genes. Found in the norway rat reference genome.

Interactions 2

According to PSICQUIC, Rattus norvegicus (Norway rat) rno-miR-339-5p interacts with:

Interaction id Participant Synonyms
URS000003FD55_10116-0 A0A0G2JZZ5 A0A0G2JZZ5
URS000003FD55_10116-1 A0A0G2JZZ5 A0A0G2JZZ5

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    UCCCUGUCCUCCAGGAGCUCACG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 13 other species