Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Cricetulus griseus (Chinese hamster) cgr-miR-339 URS000003FD55_10029

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Cricetulus griseus. Annotated by 2 databases (miRBase, RefSeq). Cricetulus griseus (Chinese hamster) cgr-miR-339 sequence is a product of miR-339, cgr-miR-339, Mir339 genes. Found in the chinese hamster reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCCUGUCCUCCAGGAGCUCACG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 66 other species

    1. Cavia porcellus cpo-miR-339-5p
    2. Dasypus novemcinctus (nine-banded armadillo) dno-miR-339-5p
    3. Echinops telfairi Ete-Mir-339_5p (mature (guide))
    4. Homo sapiens (human) hsa-miR-339-5p
    5. Macaca mulatta mml-miR-339-5p
    6. Mus musculus mmu-miR-339-5p
    7. Oryctolagus cuniculus (rabbit) Ocu-Mir-339_5p* (star (passenger))
    8. Pongo pygmaeus (Bornean orangutan) ppy-miR-339-5p
    9. Rattus norvegicus rno-miR-339-5p
    Publications New