Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p URS000003F252_9986

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Oryctolagus cuniculus. Annotated by 2 databases (miRBase, RefSeq). Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p sequence is a product of ocu-miR-181a, miR-181a, MIR181A-1, miR-181, miR-181a-3p, ocu-miR-181a-3p genes. Found in the rabbit reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACCAUCGACCGUUGAUUGUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Alligator mississippiensis (American alligator) ami-miR-181a-3p
    2. Anolis carolinensis Aca-Mir-181-P1a_3p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-181-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-181-P1a_3p* (star (passenger))
    5. Cavia porcellus cpo-miR-181a-3p
    6. Cervus elaphus (red deer) cel-miR-181a-3p
    7. Chiloscyllium plagiosum microRNA cpl-miR-181a*
    8. Chrysemys picta bellii Cpi-Mir-181-P1a_3p* (star (passenger))
    9. Columba livia cli-miR-181a-3p
    10. Cricetulus griseus cgr-miR-181a-3p
    11. Danio rerio (zebrafish) dre-miR-181a-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-181a-3p
    13. Gallus gallus (chicken) gga-miR-181a-3p
    14. Gorilla gorilla ggo-miR-181a-3p
    15. Homo sapiens (human) hsa-miR-181a-3p
    16. Lagothrix lagotricha lla-miR-181a-3p
    17. Macaca mulatta mml-miR-181a-3p
    18. Macaca nemestrina (pig-tailed macaque) mne-miR-181a-3p
    19. Monodelphis domestica Mdo-Mir-181-P1a_3p* (star (passenger))
    20. Mus musculus mmu-miR-181a-1-3p
    21. Ornithorhynchus anatinus oan-miR-181a-1-3p
    22. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-3p
    23. Pan troglodytes ptr-miR-181a-3p
    24. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-3p
    25. Pteropus alecto (black flying fox) pal-miR-181a-3p
    26. Rattus norvegicus rno-miR-181a-1-3p
    27. Sarcophilus harrisii Sha-Mir-181-P1a_3p* (star (passenger))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1a_3p* (star (passenger))
    29. Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p
    30. Takifugu rubripes (torafugu) fru-miR-181a-3p
    31. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181a-3p
    32. Tor tambroides miR-181a-3p
    Publications New