Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lagothrix lagotricha (brown woolly monkey) lla-miR-181a-3p URS000003F252_9519

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Lagothrix lagotricha. Annotated by 1 database (miRBase).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACCAUCGACCGUUGAUUGUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Alligator mississippiensis ami-miR-181a-3p
    2. Anolis carolinensis Aca-Mir-181-P1a_3p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-181-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-181-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-181a-3p
    6. Cervus elaphus cel-miR-181a-3p
    7. Chiloscyllium plagiosum microRNA cpl-miR-181a*
    8. Chrysemys picta bellii Cpi-Mir-181-P1a_3p* (star (passenger))
    9. Columba livia (rock pigeon) cli-miR-181a-3p
    10. Cricetulus griseus (Chinese hamster) cgr-miR-181a-3p
    11. Danio rerio dre-miR-181a-3p
    12. Dasypus novemcinctus dno-miR-181a-3p
    13. Gallus gallus (chicken) gga-miR-181a-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-181a-3p
    15. Homo sapiens hsa-miR-181a-3p
    16. Macaca mulatta mml-miR-181a-3p
    17. Macaca nemestrina mne-miR-181a-3p
    18. Monodelphis domestica Mdo-Mir-181-P1a_3p* (star (passenger))
    19. Mus musculus mmu-miR-181a-1-3p
    20. Ornithorhynchus anatinus (platypus) oan-miR-181a-1-3p
    21. Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p
    22. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-3p
    23. Pan troglodytes (chimpanzee) ptr-miR-181a-3p
    24. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-3p
    25. Pteropus alecto pal-miR-181a-3p
    26. Rattus norvegicus (Norway rat) rno-miR-181a-1-3p
    27. Sarcophilus harrisii Sha-Mir-181-P1a_3p* (star (passenger))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1a_3p* (star (passenger))
    29. Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p
    30. Takifugu rubripes fru-miR-181a-3p
    31. Tetraodon nigroviridis tni-miR-181a-3p
    32. Tor tambroides (Thai mahseer) miR-181a-3p