Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p URS000003F252_59729

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    ACCAUCGACCGUUGAUUGUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 25 other species

    1. Alligator mississippiensis (American alligator) ami-miR-181a-3p
    2. Cavia porcellus cpo-miR-181a-3p
    3. Cervus elaphus (red deer) cel-miR-181a-3p
    4. Chiloscyllium plagiosum microRNA cpl-miR-181a*
    5. Columba livia cli-miR-181a-3p
    6. Cricetulus griseus cgr-miR-181a-3p
    7. Danio rerio (zebrafish) dre-miR-181a-3p
    8. Dasypus novemcinctus dno-miR-181a-3p
    9. Gallus gallus gga-miR-181a-3p
    10. Gorilla gorilla ggo-miR-181a-3p
    11. Homo sapiens (human) hsa-miR-181a-3p
    12. Lagothrix lagotricha lla-miR-181a-3p
    13. Macaca mulatta (Rhesus monkey) mml-miR-181a-3p
    14. Macaca nemestrina mne-miR-181a-3p
    15. Mus musculus mmu-miR-181a-1-3p
    16. Ornithorhynchus anatinus oan-miR-181a-1-3p
    17. Oryctolagus cuniculus ocu-miR-181a-3p
    18. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-3p
    19. Pan troglodytes ptr-miR-181a-3p
    20. Pongo pygmaeus ppy-miR-181a-3p
    21. Pteropus alecto pal-miR-181a-3p
    22. Rattus norvegicus (Norway rat) rno-miR-181a-1-3p
    23. Takifugu rubripes fru-miR-181a-3p
    24. Tetraodon nigroviridis tni-miR-181a-3p
    25. Tor tambroides (Thai mahseer) miR-181a-3p
    26. Gorilla gorilla gorilla None
    Publications