Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p URS000003F252_59729

Automated summary: This miRNA sequence is 22 nucleotides long and is found in Taeniopygia guttata. Annotated by 3 databases (MirGeneDB, miRBase, RefSeq). Described in 5 papers. Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p sequence is a product of tgu-miR-181a-1-3p, miR-181a-1-3p, tgu-miR-181a-1, miR-181a-1, MIR181A-1 genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCAUCGACCGUUGAUUGUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 47 other species

    1. Alligator mississippiensis ami-miR-181a-3p
    2. Anolis carolinensis Aca-Mir-181-P1a_3p* (star (passenger))
    3. Bos taurus (cattle) Bta-Mir-181-P1a_3p* (star (passenger))
    4. Canis lupus familiaris Cfa-Mir-181-P1a_3p* (star (passenger))
    5. Cavia porcellus (domestic guinea pig) cpo-miR-181a-3p
    6. Cervus elaphus (red deer) cel-miR-181a-3p
    7. Chiloscyllium plagiosum microRNA cpl-miR-181a*
    8. Chrysemys picta bellii Cpi-Mir-181-P1a_3p* (star (passenger))
    9. Columba livia (rock pigeon) cli-miR-181a-3p
    10. Cricetulus griseus cgr-miR-181a-3p
    11. Danio rerio (zebrafish) dre-miR-181a-3p
    12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-181a-3p
    13. Gallus gallus (chicken) gga-miR-181a-3p
    14. Gorilla gorilla (western gorilla) ggo-miR-181a-3p
    15. Homo sapiens hsa-miR-181a-3p
    16. Lagothrix lagotricha lla-miR-181a-3p
    17. Macaca mulatta mml-miR-181a-3p
    18. Macaca nemestrina (pig-tailed macaque) mne-miR-181a-3p
    19. Monodelphis domestica Mdo-Mir-181-P1a_3p* (star (passenger))
    20. Mus musculus (house mouse) mmu-miR-181a-1-3p
    21. Ornithorhynchus anatinus oan-miR-181a-1-3p
    22. Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p
    23. Pan paniscus ppa-miR-181a-3p
    24. Pan troglodytes (chimpanzee) ptr-miR-181a-3p
    25. Pongo pygmaeus ppy-miR-181a-3p
    26. Pteropus alecto pal-miR-181a-3p
    27. Rattus norvegicus rno-miR-181a-1-3p
    28. Sarcophilus harrisii Sha-Mir-181-P1a_3p* (star (passenger))
    29. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1a_3p* (star (passenger))
    30. Takifugu rubripes (torafugu) fru-miR-181a-3p
    31. Tetraodon nigroviridis tni-miR-181a-3p
    32. Tor tambroides miR-181a-3p