Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Anolis carolinensis (green anole) Aca-Mir-181-P1a_3p* (star (passenger)) URS000003F252_28377

  • 22 nucleotides
  • 1 database (MirGeneDB)
  • Found in 178 species
  • miRNA

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    ACCAUCGACCGUUGAUUGUACC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 177 other species

    1. Alligator mississippiensis (American alligator) ami-miR-181a-3p
    2. Bos taurus (cattle) Bta-Mir-181-P1a_3p* (star (passenger))
    3. Canis lupus familiaris Cfa-Mir-181-P1a_3p* (star (passenger))
    4. Cavia porcellus cpo-miR-181a-3p
    5. Cervus elaphus (red deer) cel-miR-181a-3p
    6. Chiloscyllium plagiosum microRNA cpl-miR-181a*
    7. Chrysemys picta bellii Cpi-Mir-181-P1a_3p* (star (passenger))
    8. Columba livia cli-miR-181a-3p
    9. Cricetulus griseus cgr-miR-181a-3p
    10. Danio rerio (zebrafish) dre-miR-181a-3p
    11. Dasypus novemcinctus (nine-banded armadillo) dno-miR-181a-3p
    12. Gallus gallus (chicken) gga-miR-181a-3p
    13. Gorilla gorilla ggo-miR-181a-3p
    14. Homo sapiens (human) hsa-miR-181a-3p
    15. Lagothrix lagotricha lla-miR-181a-3p
    16. Macaca mulatta mml-miR-181a-3p
    17. Macaca nemestrina (pig-tailed macaque) mne-miR-181a-3p
    18. Monodelphis domestica Mdo-Mir-181-P1a_3p* (star (passenger))
    19. Mus musculus mmu-miR-181a-1-3p
    20. Ornithorhynchus anatinus oan-miR-181a-1-3p
    21. Oryctolagus cuniculus (rabbit) ocu-miR-181a-3p
    22. Pan paniscus (pygmy chimpanzee) ppa-miR-181a-3p
    23. Pan troglodytes ptr-miR-181a-3p
    24. Pongo pygmaeus (Bornean orangutan) ppy-miR-181a-3p
    25. Pteropus alecto (black flying fox) pal-miR-181a-3p
    26. Rattus norvegicus rno-miR-181a-1-3p
    27. Sarcophilus harrisii Sha-Mir-181-P1a_3p* (star (passenger))
    28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-181-P1a_3p* (star (passenger))
    29. Taeniopygia guttata (zebra finch) tgu-miR-181a-1-3p
    30. Takifugu rubripes (torafugu) fru-miR-181a-3p
    31. Tetraodon nigroviridis (spotted green pufferfish) tni-miR-181a-3p
    32. Tor tambroides miR-181a-3p