Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Escherichia coli K-12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) secondary structure diagram

Escherichia coli K-12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1) URS000003E908_83333

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCGCGUUAACAAAGCGGUUAUGUAGCGGAUUGCAAAUCCGUCUAGUCCGGUUCGACUCCGGAACGCGCCUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4,828 other species

  1. Escherichia coli tRNA-Cys(gca)
  2. Aeromonadaceae bacterium (wastewater metagenome) tRNA-Cys
  3. Chania multitudinisentens RB-25 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4. compost metagenome tRNA-Cys
  5. Edwardsiella anguillarum ET080813 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1, tRNA-Cys-GCA-1-2)
  6. Edwardsiella anguillarum tRNA-Cys(gca)
  7. Edwardsiella hoshinae tRNA-Cys(gca)
  8. Edwardsiella ictaluri 93-146 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  9. Edwardsiella ictaluri tRNA-Cys(gca)
  10. Edwardsiella piscicida C07-087 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
  11. Edwardsiella piscicida tRNA-Cys
  12. Edwardsiella sp. EA181011 tRNA-Cys
  13. Edwardsiella sp. LADL05-105 tRNA-Cys
  14. Edwardsiella tarda ATCC 15947 = NBRC 105688 tRNA-Cys
  15. Edwardsiella tarda ATCC 23685 tRNA-Cys
  16. Edwardsiella tarda EIB202 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
  17. Edwardsiella tarda FL6-60 tRNA-Cys (GCA) (tRNA-Cys-GCA-2-1)
  18. Edwardsiella tarda tRNA-Cys(gca)
  19. Enterobacillus tribolii tRNA-Cys
  20. Enterobacterales bacterium 8AC tRNA-Cys
  21. Enterobacterales bacterium tRNA-Cys
  22. Enterobacter hormaechei tRNA-Cys
  23. Enterobacteriaceae bacterium 8376wB8 tRNA-Cys
  24. Enterobacteriaceae bacterium 8376wD7 tRNA-Cys
  25. Enterobacteriaceae bacterium 8376wG6 tRNA-Cys
  26. Enterobacteriaceae bacterium 9_2_54FAA tRNA-Cys
  27. Enterobacteriaceae bacterium tRNA-Cys
  28. Enterobacteriaceae bacterium TzEc013 tRNA-Cys
  29. Enterobacteriaceae bacterium TzEc051 tRNA-Cys
  30. Enterobacteriaceae bacterium TzEc052 tRNA-Cys
  31. Enterobacteriaceae bacterium TzEc058 tRNA-Cys
  32. Enterobacteriaceae bacterium TzEc077 tRNA-Cys
  33. Enterobacteriaceae bacterium TzEc084 tRNA-Cys
  34. Enterobacter sp. EC-NT1 tRNA-Cys
  35. Erwinia sp. CPCC 100877 tRNA-Cys
  36. Escherichia albertii B156 tRNA-Cys
  37. Escherichia albertii KF1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  38. Escherichia albertii tRNA-Cys(gca)
  39. Escherichia albertii TW07627 tRNA-Cys
  40. Escherichia coli 0.1288 tRNA-Cys
  41. Escherichia coli 0.1304 tRNA-Cys
  42. Escherichia coli 042 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  43. Escherichia coli 07798 tRNA-Cys
  44. Escherichia coli 08BKT055439 tRNA-Cys
  45. Escherichia coli 08BKT77219 tRNA-Cys
  46. Escherichia coli 09BKT024447 tRNA-Cys
  47. Escherichia coli 09BKT076207 tRNA-Cys
  48. Escherichia coli 10.0821 tRNA-Cys
  49. Escherichia coli 10.0833 tRNA-Cys
  50. Escherichia coli 10.0869 tRNA-Cys
  51. Escherichia coli 101-1 tRNA-Cys
  52. Escherichia coli 110957 tRNA-Cys
  53. Escherichia coli 1-110-08_S1_C1 tRNA-Cys
  54. Escherichia coli 1-110-08_S1_C2 tRNA-Cys
  55. Escherichia coli 1-110-08_S1_C3 tRNA-Cys
  56. Escherichia coli 1-110-08_S3_C1 tRNA-Cys
  57. Escherichia coli 1-110-08_S3_C2 tRNA-Cys
  58. Escherichia coli 1-110-08_S3_C3 tRNA-Cys
  59. Escherichia coli 1-110-08_S4_C1 tRNA-Cys
  60. Escherichia coli 1-110-08_S4_C2 tRNA-Cys
  61. Escherichia coli 1-110-08_S4_C3 tRNA-Cys
  62. Escherichia coli 113290 tRNA-Cys
  63. Escherichia coli 113302 tRNA-Cys
  64. Escherichia coli 113303 tRNA-Cys
  65. Escherichia coli 1-176-05_S1_C1 tRNA-Cys
  66. Escherichia coli 1-176-05_S1_C2 tRNA-Cys
  67. Escherichia coli 1-176-05_S1_C3 tRNA-Cys
  68. Escherichia coli 1-176-05_S3_C1 tRNA-Cys
  69. Escherichia coli 1-176-05_S3_C2 tRNA-Cys
  70. Escherichia coli 1-176-05_S4_C1 tRNA-Cys
  71. Escherichia coli 1-176-05_S4_C2 tRNA-Cys
  72. Escherichia coli 1-176-05_S4_C3 tRNA-Cys
  73. Escherichia coli 1-182-04_S1_C1 tRNA-Cys
  74. Escherichia coli 1-182-04_S1_C2 tRNA-Cys
  75. Escherichia coli 1-182-04_S1_C3 tRNA-Cys
  76. Escherichia coli 1-182-04_S3_C1 tRNA-Cys
  77. Escherichia coli 1-182-04_S3_C2 tRNA-Cys
  78. Escherichia coli 1-182-04_S3_C3 tRNA-Cys
  79. Escherichia coli 1-182-04_S4_C1 tRNA-Cys
  80. Escherichia coli 1-182-04_S4_C2 tRNA-Cys
  81. Escherichia coli 1-182-04_S4_C3 tRNA-Cys
  82. Escherichia coli 1.2264 tRNA-Cys
  83. Escherichia coli 1-250-04_S1_C1 tRNA-Cys
  84. Escherichia coli 1-250-04_S1_C2 tRNA-Cys
  85. Escherichia coli 1-250-04_S1_C3 tRNA-Cys
  86. Escherichia coli 1-250-04_S3_C1 tRNA-Cys
  87. Escherichia coli 1-250-04_S3_C2 tRNA-Cys
  88. Escherichia coli 1-250-04_S4_C1 tRNA-Cys
  89. Escherichia coli 1-250-04_S4_C2 tRNA-Cys
  90. Escherichia coli 1.2741 tRNA-Cys
  91. Escherichia coli 1303 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  92. Escherichia coli 1-392-07_S1_C1 tRNA-Cys
  93. Escherichia coli 1-392-07_S1_C2 tRNA-Cys
  94. Escherichia coli 1-392-07_S3_C1 tRNA-Cys
  95. Escherichia coli 1-392-07_S3_C2 tRNA-Cys
  96. Escherichia coli 1-392-07_S3_C3 tRNA-Cys
  97. Escherichia coli 1-392-07_S4_C1 tRNA-Cys
  98. Escherichia coli 1-392-07_S4_C2 tRNA-Cys
  99. Escherichia coli 1-392-07_S4_C3 tRNA-Cys
  100. Escherichia coli 14A tRNA-Cys
  101. Escherichia coli 174750 tRNA-Cys
  102. Escherichia coli 174900 tRNA-Cys
  103. Escherichia coli 178200 tRNA-Cys
  104. Escherichia coli 178850 tRNA-Cys
  105. Escherichia coli 178900 tRNA-Cys
  106. Escherichia coli 179100 tRNA-Cys
  107. Escherichia coli 179550 tRNA-Cys
  108. Escherichia coli 180050 tRNA-Cys
  109. Escherichia coli 180200 tRNA-Cys
  110. Escherichia coli 180600 tRNA-Cys
  111. Escherichia coli 1827-70 tRNA-Cys
  112. Escherichia coli 199900.1 tRNA-Cys
  113. Escherichia coli 2-005-03_S1_C1 tRNA-Cys
  114. Escherichia coli 2-005-03_S1_C2 tRNA-Cys
  115. Escherichia coli 2-005-03_S1_C3 tRNA-Cys
  116. Escherichia coli 2-005-03_S3_C1 tRNA-Cys
  117. Escherichia coli 2-005-03_S3_C2 tRNA-Cys
  118. Escherichia coli 2-005-03_S3_C3 tRNA-Cys
  119. Escherichia coli 2-005-03_S4_C1 tRNA-Cys
  120. Escherichia coli 2-005-03_S4_C2 tRNA-Cys
  121. Escherichia coli 2-005-03_S4_C3 tRNA-Cys
  122. Escherichia coli 2-011-08_S1_C1 tRNA-Cys
  123. Escherichia coli 2-011-08_S1_C2 tRNA-Cys
  124. Escherichia coli 2-011-08_S1_C3 tRNA-Cys
  125. Escherichia coli 2-011-08_S3_C1 tRNA-Cys
  126. Escherichia coli 2-011-08_S3_C2 tRNA-Cys
  127. Escherichia coli 2-011-08_S3_C3 tRNA-Cys
  128. Escherichia coli 2-011-08_S4_C1 tRNA-Cys
  129. Escherichia coli 2-011-08_S4_C3 tRNA-Cys
  130. Escherichia coli 201600.1 tRNA-Cys
  131. Escherichia coli 2-052-05_S1_C1 tRNA-Cys
  132. Escherichia coli 2-052-05_S1_C3 tRNA-Cys
  133. Escherichia coli 2-052-05_S3_C1 tRNA-Cys
  134. Escherichia coli 2-052-05_S3_C2 tRNA-Cys
  135. Escherichia coli 2-052-05_S3_C3 tRNA-Cys
  136. Escherichia coli 2-052-05_S4_C1 tRNA-Cys
  137. Escherichia coli 2-052-05_S4_C2 tRNA-Cys
  138. Escherichia coli 2-052-05_S4_C3 tRNA-Cys
  139. Escherichia coli 2-156-04_S1_C3 tRNA-Cys
  140. Escherichia coli 2-156-04_S3_C1 tRNA-Cys
  141. Escherichia coli 2-156-04_S3_C2 tRNA-Cys
  142. Escherichia coli 2-156-04_S3_C3 tRNA-Cys
  143. Escherichia coli 2-156-04_S4_C1 tRNA-Cys
  144. Escherichia coli 2-156-04_S4_C2 tRNA-Cys
  145. Escherichia coli 2-156-04_S4_C3 tRNA-Cys
  146. Escherichia coli 2-177-06_S1_C1 tRNA-Cys
  147. Escherichia coli 2-177-06_S1_C2 tRNA-Cys
  148. Escherichia coli 2-177-06_S1_C3 tRNA-Cys
  149. Escherichia coli 2-177-06_S3_C1 tRNA-Cys
  150. Escherichia coli 2-177-06_S3_C2 tRNA-Cys
  151. Escherichia coli 2-177-06_S3_C3 tRNA-Cys
  152. Escherichia coli 2-177-06_S4_C1 tRNA-Cys
  153. Escherichia coli 2-177-06_S4_C2 tRNA-Cys
  154. Escherichia coli 2-177-06_S4_C3 tRNA-Cys
  155. Escherichia coli 2-210-07_S1_C2 tRNA-Cys
  156. Escherichia coli 2-210-07_S1_C3 tRNA-Cys
  157. Escherichia coli 2-210-07_S3_C1 tRNA-Cys
  158. Escherichia coli 2-210-07_S3_C2 tRNA-Cys
  159. Escherichia coli 2-210-07_S3_C3 tRNA-Cys
  160. Escherichia coli 2-210-07_S4_C1 tRNA-Cys
  161. Escherichia coli 2-210-07_S4_C2 tRNA-Cys
  162. Escherichia coli 2-210-07_S4_C3 tRNA-Cys
  163. Escherichia coli 2-222-05_S1_C1 tRNA-Cys
  164. Escherichia coli 2-222-05_S1_C2 tRNA-Cys
  165. Escherichia coli 2-222-05_S1_C3 tRNA-Cys
  166. Escherichia coli 2-222-05_S3_C1 tRNA-Cys
  167. Escherichia coli 2-222-05_S3_C2 tRNA-Cys
  168. Escherichia coli 2-222-05_S3_C3 tRNA-Cys
  169. Escherichia coli 2-222-05_S4_C1 tRNA-Cys
  170. Escherichia coli 2-222-05_S4_C2 tRNA-Cys
  171. Escherichia coli 2-222-05_S4_C3 tRNA-Cys
  172. Escherichia coli 2-316-03_S1_C1 tRNA-Cys
  173. Escherichia coli 2-316-03_S1_C2 tRNA-Cys
  174. Escherichia coli 2-316-03_S3_C1 tRNA-Cys
  175. Escherichia coli 2-316-03_S3_C2 tRNA-Cys
  176. Escherichia coli 2-316-03_S3_C3 tRNA-Cys
  177. Escherichia coli 2-316-03_S4_C1 tRNA-Cys
  178. Escherichia coli 2-316-03_S4_C2 tRNA-Cys
  179. Escherichia coli 2-316-03_S4_C3 tRNA-Cys
  180. Escherichia coli 2362-75 tRNA-Cys
  181. Escherichia coli 2.3916 tRNA-Cys
  182. Escherichia coli 2.4168 tRNA-Cys
  183. Escherichia coli 2-427-07_S1_C1 tRNA-Cys
  184. Escherichia coli 2-427-07_S1_C2 tRNA-Cys
  185. Escherichia coli 2-427-07_S1_C3 tRNA-Cys
  186. Escherichia coli 2-427-07_S3_C1 tRNA-Cys
  187. Escherichia coli 2-427-07_S3_C3 tRNA-Cys
  188. Escherichia coli 2-427-07_S4_C1 tRNA-Cys
  189. Escherichia coli 2-427-07_S4_C2 tRNA-Cys
  190. Escherichia coli 2-427-07_S4_C3 tRNA-Cys
  191. Escherichia coli 2-460-02_S1_C1 tRNA-Cys
  192. Escherichia coli 2-460-02_S1_C2 tRNA-Cys
  193. Escherichia coli 2-460-02_S1_C3 tRNA-Cys
  194. Escherichia coli 2-460-02_S3_C1 tRNA-Cys
  195. Escherichia coli 2-460-02_S3_C2 tRNA-Cys
  196. Escherichia coli 2-460-02_S3_C3 tRNA-Cys
  197. Escherichia coli 2-460-02_S4_C1 tRNA-Cys
  198. Escherichia coli 2-460-02_S4_C2 tRNA-Cys
  199. Escherichia coli 2-460-02_S4_C3 tRNA-Cys
  200. Escherichia coli 2-474-04_S1_C1 tRNA-Cys
  201. Escherichia coli 2-474-04_S1_C2 tRNA-Cys
  202. Escherichia coli 2-474-04_S3_C1 tRNA-Cys
  203. Escherichia coli 2-474-04_S3_C2 tRNA-Cys
  204. Escherichia coli 2-474-04_S3_C3 tRNA-Cys
  205. Escherichia coli 2-474-04_S4_C1 tRNA-Cys
  206. Escherichia coli 2-474-04_S4_C2 tRNA-Cys
  207. Escherichia coli 2-474-04_S4_C3 tRNA-Cys
  208. Escherichia coli 2534-86 tRNA-Cys
  209. Escherichia coli 2719100 tRNA-Cys
  210. Escherichia coli 2720900 tRNA-Cys
  211. Escherichia coli 2722950 tRNA-Cys
  212. Escherichia coli 2726800 tRNA-Cys
  213. Escherichia coli 2726950 tRNA-Cys
  214. Escherichia coli 2729250 tRNA-Cys
  215. Escherichia coli 2730350 tRNA-Cys
  216. Escherichia coli 2730450 tRNA-Cys
  217. Escherichia coli 2731150 tRNA-Cys
  218. Escherichia coli 2733950 tRNA-Cys
  219. Escherichia coli 2735000 tRNA-Cys
  220. Escherichia coli 2741950 tRNA-Cys
  221. Escherichia coli 2747800 tRNA-Cys
  222. Escherichia coli 2749250 tRNA-Cys
  223. Escherichia coli 2756500 tRNA-Cys
  224. Escherichia coli 2762100 tRNA-Cys
  225. Escherichia coli 2770900 tRNA-Cys
  226. Escherichia coli 2780750 tRNA-Cys
  227. Escherichia coli 2785200 tRNA-Cys
  228. Escherichia coli 2788150 tRNA-Cys
  229. Escherichia coli 2845350 tRNA-Cys
  230. Escherichia coli 2845650 tRNA-Cys
  231. Escherichia coli 2846750 tRNA-Cys
  232. Escherichia coli 2848050 tRNA-Cys
  233. Escherichia coli 2850400 tRNA-Cys
  234. Escherichia coli 2850750 tRNA-Cys
  235. Escherichia coli 2851500 tRNA-Cys
  236. Escherichia coli 2853500 tRNA-Cys
  237. Escherichia coli 2854350 tRNA-Cys
  238. Escherichia coli 2860050 tRNA-Cys
  239. Escherichia coli 2860650 tRNA-Cys
  240. Escherichia coli 2861200 tRNA-Cys
  241. Escherichia coli 2862600 tRNA-Cys
  242. Escherichia coli 2864350 tRNA-Cys
  243. Escherichia coli 2865200 tRNA-Cys
  244. Escherichia coli 2866350 tRNA-Cys
  245. Escherichia coli 2866450 tRNA-Cys
  246. Escherichia coli 2866550 tRNA-Cys
  247. Escherichia coli 2866750 tRNA-Cys
  248. Escherichia coli 2867750 tRNA-Cys
  249. Escherichia coli 2871950 tRNA-Cys
  250. Escherichia coli 2872000 tRNA-Cys
  251. Escherichia coli 2872800 tRNA-Cys
  252. Escherichia coli 2875000 tRNA-Cys
  253. Escherichia coli 2875150 tRNA-Cys
  254. Escherichia coli 2886-75 tRNA-Cys
  255. Escherichia coli 3003 tRNA-Cys
  256. Escherichia coli 3006 tRNA-Cys
  257. Escherichia coli 3-020-07_S1_C1 tRNA-Cys
  258. Escherichia coli 3-020-07_S1_C2 tRNA-Cys
  259. Escherichia coli 3-020-07_S1_C3 tRNA-Cys
  260. Escherichia coli 3-020-07_S3_C1 tRNA-Cys
  261. Escherichia coli 3-020-07_S3_C2 tRNA-Cys
  262. Escherichia coli 3-020-07_S4_C1 tRNA-Cys
  263. Escherichia coli 3-020-07_S4_C2 tRNA-Cys
  264. Escherichia coli 3-020-07_S4_C3 tRNA-Cys
  265. Escherichia coli 3030-1 tRNA-Cys
  266. Escherichia coli 3-073-06_S1_C1 tRNA-Cys
  267. Escherichia coli 3-073-06_S1_C2 tRNA-Cys
  268. Escherichia coli 3-073-06_S3_C1 tRNA-Cys
  269. Escherichia coli 3-073-06_S3_C2 tRNA-Cys
  270. Escherichia coli 3-073-06_S4_C1 tRNA-Cys
  271. Escherichia coli 3-073-06_S4_C2 tRNA-Cys
  272. Escherichia coli 3-073-06_S4_C3 tRNA-Cys
  273. Escherichia coli 3-105-05_S1_C1 tRNA-Cys
  274. Escherichia coli 3-105-05_S1_C2 tRNA-Cys
  275. Escherichia coli 3-105-05_S1_C3 tRNA-Cys
  276. Escherichia coli 3-105-05_S3_C1 tRNA-Cys
  277. Escherichia coli 3-105-05_S3_C2 tRNA-Cys
  278. Escherichia coli 3-105-05_S3_C3 tRNA-Cys
  279. Escherichia coli 3-105-05_S4_C1 tRNA-Cys
  280. Escherichia coli 3-105-05_S4_C2 tRNA-Cys
  281. Escherichia coli 3-105-05_S4_C3 tRNA-Cys
  282. Escherichia coli 3.2303 tRNA-Cys
  283. Escherichia coli 3.2608 tRNA-Cys
  284. Escherichia coli 3-267-03_S1_C1 tRNA-Cys
  285. Escherichia coli 3-267-03_S1_C2 tRNA-Cys
  286. Escherichia coli 3-267-03_S1_C3 tRNA-Cys
  287. Escherichia coli 3-267-03_S3_C1 tRNA-Cys
  288. Escherichia coli 3-267-03_S3_C2 tRNA-Cys
  289. Escherichia coli 3-267-03_S4_C1 tRNA-Cys
  290. Escherichia coli 3-267-03_S4_C2 tRNA-Cys
  291. Escherichia coli 3-373-03_S1_C1 tRNA-Cys
  292. Escherichia coli 3-373-03_S1_C2 tRNA-Cys
  293. Escherichia coli 3-373-03_S1_C3 tRNA-Cys
  294. Escherichia coli 3-373-03_S3_C1 tRNA-Cys
  295. Escherichia coli 3-373-03_S3_C2 tRNA-Cys
  296. Escherichia coli 3-373-03_S3_C3 tRNA-Cys
  297. Escherichia coli 3-373-03_S4_C1 tRNA-Cys
  298. Escherichia coli 3-373-03_S4_C2 tRNA-Cys
  299. Escherichia coli 3-373-03_S4_C3 tRNA-Cys
  300. Escherichia coli 3.3884 tRNA-Cys
  301. Escherichia coli 3431 tRNA-Cys
  302. Escherichia coli 3-475-03_S1_C1 tRNA-Cys
  303. Escherichia coli 3-475-03_S1_C2 tRNA-Cys
  304. Escherichia coli 3-475-03_S3_C1 tRNA-Cys
  305. Escherichia coli 3-475-03_S3_C2 tRNA-Cys
  306. Escherichia coli 3-475-03_S4_C1 tRNA-Cys
  307. Escherichia coli 3-475-03_S4_C2 tRNA-Cys
  308. Escherichia coli 3.4870 tRNA-Cys
  309. Escherichia coli 3.4880 tRNA-Cys
  310. Escherichia coli 4.0522 tRNA-Cys
  311. Escherichia coli 4.0967 tRNA-Cys
  312. Escherichia coli 4_1_47FAA tRNA-Cys
  313. Escherichia coli 4-203-08_S1_C1 tRNA-Cys
  314. Escherichia coli 4-203-08_S1_C2 tRNA-Cys
  315. Escherichia coli 4-203-08_S1_C3 tRNA-Cys
  316. Escherichia coli 4-203-08_S3_C1 tRNA-Cys
  317. Escherichia coli 4-203-08_S3_C2 tRNA-Cys
  318. Escherichia coli 4-203-08_S3_C3 tRNA-Cys
  319. Escherichia coli 4-203-08_S4_C2 tRNA-Cys
  320. Escherichia coli 4-203-08_S4_C3 tRNA-Cys
  321. Escherichia coli 5.0588 tRNA-Cys
  322. Escherichia coli 5.0959 tRNA-Cys
  323. Escherichia coli 5-172-05_S1_C3 tRNA-Cys
  324. Escherichia coli 5-172-05_S3_C1 tRNA-Cys
  325. Escherichia coli 5-172-05_S3_C3 tRNA-Cys
  326. Escherichia coli 5-172-05_S4_C1 tRNA-Cys
  327. Escherichia coli 5-172-05_S4_C2 tRNA-Cys
  328. Escherichia coli 5-172-05_S4_C3 tRNA-Cys
  329. Escherichia coli 5.2239 tRNA-Cys
  330. Escherichia coli 53638 tRNA-Cys
  331. Escherichia coli 5-366-08_S1_C1 tRNA-Cys
  332. Escherichia coli 5-366-08_S1_C3 tRNA-Cys
  333. Escherichia coli 5-366-08_S3_C1 tRNA-Cys
  334. Escherichia coli 5-366-08_S3_C2 tRNA-Cys
  335. Escherichia coli 5-366-08_S3_C3 tRNA-Cys
  336. Escherichia coli 5-366-08_S4_C1 tRNA-Cys
  337. Escherichia coli 5-366-08_S4_C2 tRNA-Cys
  338. Escherichia coli 536 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  339. Escherichia coli 541-15 tRNA-Cys
  340. Escherichia coli 541-1 tRNA-Cys
  341. Escherichia coli 5412 tRNA-Cys
  342. Escherichia coli 55989 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  343. Escherichia coli 576-1 tRNA-Cys
  344. Escherichia coli 5905 tRNA-Cys
  345. Escherichia coli 6.0172 tRNA-Cys
  346. Escherichia coli 6-175-07_S1_C1 tRNA-Cys
  347. Escherichia coli 6-175-07_S1_C2 tRNA-Cys
  348. Escherichia coli 6-175-07_S1_C3 tRNA-Cys
  349. Escherichia coli 6-175-07_S3_C1 tRNA-Cys
  350. Escherichia coli 6-175-07_S3_C2 tRNA-Cys
  351. Escherichia coli 6-175-07_S3_C3 tRNA-Cys
  352. Escherichia coli 6-175-07_S4_C1 tRNA-Cys
  353. Escherichia coli 6-175-07_S4_C2 tRNA-Cys
  354. Escherichia coli 6-175-07_S4_C3 tRNA-Cys
  355. Escherichia coli 6-319-05_S1_C1 tRNA-Cys
  356. Escherichia coli 6-319-05_S1_C2 tRNA-Cys
  357. Escherichia coli 6-319-05_S1_C3 tRNA-Cys
  358. Escherichia coli 6-319-05_S3_C1 tRNA-Cys
  359. Escherichia coli 6-319-05_S3_C2 tRNA-Cys
  360. Escherichia coli 6-319-05_S3_C3 tRNA-Cys
  361. Escherichia coli 6-319-05_S4_C2 tRNA-Cys
  362. Escherichia coli 6-319-05_S4_C3 tRNA-Cys
  363. Escherichia coli 6-537-08_S1_C1 tRNA-Cys
  364. Escherichia coli 6-537-08_S1_C2 tRNA-Cys
  365. Escherichia coli 6-537-08_S1_C3 tRNA-Cys
  366. Escherichia coli 6-537-08_S3_C1 tRNA-Cys
  367. Escherichia coli 6-537-08_S3_C2 tRNA-Cys
  368. Escherichia coli 6-537-08_S3_C3 tRNA-Cys
  369. Escherichia coli 6-537-08_S4_C1 tRNA-Cys
  370. Escherichia coli 6-537-08_S4_C2 tRNA-Cys
  371. Escherichia coli 7.1982 tRNA-Cys
  372. Escherichia coli 7-233-03_S1_C2 tRNA-Cys
  373. Escherichia coli 7-233-03_S1_C3 tRNA-Cys
  374. Escherichia coli 7-233-03_S3_C1 tRNA-Cys
  375. Escherichia coli 7-233-03_S3_C2 tRNA-Cys
  376. Escherichia coli 7-233-03_S3_C3 tRNA-Cys
  377. Escherichia coli 7-233-03_S4_C1 tRNA-Cys
  378. Escherichia coli 7-233-03_S4_C2 tRNA-Cys
  379. Escherichia coli 7-233-03_S4_C3 tRNA-Cys
  380. Escherichia coli 75 tRNA-Cys
  381. Escherichia coli 8.0416 tRNA-Cys
  382. Escherichia coli 8.0566 tRNA-Cys
  383. Escherichia coli 8.0569 tRNA-Cys
  384. Escherichia coli 8.0586 tRNA-Cys
  385. Escherichia coli 8.2524 tRNA-Cys
  386. Escherichia coli 83972 tRNA-Cys
  387. Escherichia coli 8-415-05_S1_C1 tRNA-Cys
  388. Escherichia coli 8-415-05_S1_C2 tRNA-Cys
  389. Escherichia coli 8-415-05_S3_C1 tRNA-Cys
  390. Escherichia coli 8-415-05_S3_C2 tRNA-Cys
  391. Escherichia coli 8-415-05_S3_C3 tRNA-Cys
  392. Escherichia coli 8-415-05_S4_C1 tRNA-Cys
  393. Escherichia coli 8-415-05_S4_C2 tRNA-Cys
  394. Escherichia coli 8-415-05_S4_C3 tRNA-Cys
  395. Escherichia coli 88.0221 tRNA-Cys
  396. Escherichia coli 88.1042 tRNA-Cys
  397. Escherichia coli 88.1467 tRNA-Cys
  398. Escherichia coli 89.0511 tRNA-Cys
  399. Escherichia coli 90.0039 tRNA-Cys
  400. Escherichia coli 90.0091 tRNA-Cys
  401. Escherichia coli 900105 (10e) tRNA-Cys
  402. Escherichia coli 9.0111 tRNA-Cys
  403. Escherichia coli 902034 (7b) tRNA-Cys
  404. Escherichia coli 90.2281 tRNA-Cys
  405. Escherichia coli 907357 tRNA-Cys
  406. Escherichia coli 907391 tRNA-Cys
  407. Escherichia coli 907446 tRNA-Cys
  408. Escherichia coli 907672 tRNA-Cys
  409. Escherichia coli 907700 tRNA-Cys
  410. Escherichia coli 907701 tRNA-Cys
  411. Escherichia coli 907710 tRNA-Cys
  412. Escherichia coli 907713 tRNA-Cys
  413. Escherichia coli 907715 tRNA-Cys
  414. Escherichia coli 907779 tRNA-Cys
  415. Escherichia coli 907889 tRNA-Cys
  416. Escherichia coli 907892 tRNA-Cys
  417. Escherichia coli 908519 tRNA-Cys
  418. Escherichia coli 908521 tRNA-Cys
  419. Escherichia coli 908522 tRNA-Cys
  420. Escherichia coli 908524 tRNA-Cys
  421. Escherichia coli 908525 tRNA-Cys
  422. Escherichia coli 908541 tRNA-Cys
  423. Escherichia coli 908555 tRNA-Cys
  424. Escherichia coli 908573 tRNA-Cys
  425. Escherichia coli 908585 tRNA-Cys
  426. Escherichia coli 908616 tRNA-Cys
  427. Escherichia coli 908624 tRNA-Cys
  428. Escherichia coli 908632 tRNA-Cys
  429. Escherichia coli 908658 tRNA-Cys
  430. Escherichia coli 908675 tRNA-Cys
  431. Escherichia coli 908691 tRNA-Cys
  432. Escherichia coli 909945-2 tRNA-Cys
  433. Escherichia coli 910096-2 tRNA-Cys
  434. Escherichia coli 9.1649 tRNA-Cys
  435. Escherichia coli 93-001 tRNA-Cys
  436. Escherichia coli 93.0055 tRNA-Cys
  437. Escherichia coli 93.0056 tRNA-Cys
  438. Escherichia coli 93.0624 tRNA-Cys
  439. Escherichia coli 94.0618 tRNA-Cys
  440. Escherichia coli 95.0083 tRNA-Cys
  441. Escherichia coli 95.0183 tRNA-Cys
  442. Escherichia coli 95.0943 tRNA-Cys
  443. Escherichia coli 95.1288 tRNA-Cys
  444. Escherichia coli 95JB1 tRNA-Cys
  445. Escherichia coli 95NR1 tRNA-Cys
  446. Escherichia coli 96.0107 tRNA-Cys
  447. Escherichia coli 96.0109 tRNA-Cys
  448. Escherichia coli 96.0427 tRNA-Cys
  449. Escherichia coli 96.0428 tRNA-Cys
  450. Escherichia coli 96.0497 tRNA-Cys
  451. Escherichia coli 96.0932 tRNA-Cys
  452. Escherichia coli 96.0939 tRNA-Cys
  453. Escherichia coli 96.154 tRNA-Cys
  454. Escherichia coli 97.0003 tRNA-Cys
  455. Escherichia coli 97.0007 tRNA-Cys
  456. Escherichia coli 97.0010 tRNA-Cys
  457. Escherichia coli 97.0246 tRNA-Cys
  458. Escherichia coli 97.0259 tRNA-Cys
  459. Escherichia coli 97.0264 tRNA-Cys
  460. Escherichia coli 97.1742 tRNA-Cys
  461. Escherichia coli 99.0670 tRNA-Cys
  462. Escherichia coli 99.0672 tRNA-Cys
  463. Escherichia coli 99.0713 tRNA-Cys
  464. Escherichia coli 99.0741 tRNA-Cys
  465. Escherichia coli 99.0814 tRNA-Cys
  466. Escherichia coli 99.0815 tRNA-Cys
  467. Escherichia coli 99.0816 tRNA-Cys
  468. Escherichia coli 99.0839 tRNA-Cys
  469. Escherichia coli 99.0848 tRNA-Cys
  470. Escherichia coli 99.1753 tRNA-Cys
  471. Escherichia coli 99.1775 tRNA-Cys
  472. Escherichia coli 99.1781 tRNA-Cys
  473. Escherichia coli 99.1793 tRNA-Cys
  474. Escherichia coli 99.1805 tRNA-Cys
  475. Escherichia coli A25922R tRNA-Cys
  476. Escherichia coli A35218R tRNA-Cys
  477. Escherichia coli AA86 tRNA-Cys
  478. Escherichia coli ABU 83972 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  479. Escherichia coli ACN001 tRNA-Cys
  480. Escherichia coli AD30 tRNA-Cys
  481. Escherichia coli AI27 tRNA-Cys
  482. Escherichia coli APEC IMT5155 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  483. Escherichia coli APEC O18 tRNA-Cys
  484. Escherichia coli APEC O1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  485. Escherichia coli APEC O2-211 tRNA-Cys
  486. Escherichia coli APEC O2 tRNA-Cys
  487. Escherichia coli APEC O78 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  488. Escherichia coli ARS4.2123 tRNA-Cys
  489. Escherichia coli ATCC 25922 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  490. Escherichia coli ATCC 35150 tRNA-Cys
  491. Escherichia coli ATCC 700728 tRNA-Cys
  492. Escherichia coli ATCC 8739 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  493. Escherichia coli ATCC BAA-2192 tRNA-Cys
  494. Escherichia coli ATCC BAA-2193 tRNA-Cys
  495. Escherichia coli ATCC BAA-2196 tRNA-Cys
  496. Escherichia coli ATCC BAA-2209 tRNA-Cys
  497. Escherichia coli ATCC BAA-2215 tRNA-Cys
  498. Escherichia coli ATCC BAA-2219 tRNA-Cys
  499. Escherichia coli B088 tRNA-Cys
  500. Escherichia coli B093 tRNA-Cys
  501. Escherichia coli B102 tRNA-Cys
  502. Escherichia coli B103 tRNA-Cys
  503. Escherichia coli B104 tRNA-Cys
  504. Escherichia coli B106 tRNA-Cys
  505. Escherichia coli B107 tRNA-Cys
  506. Escherichia coli B108 tRNA-Cys
  507. Escherichia coli B109 tRNA-Cys
  508. Escherichia coli B112 tRNA-Cys
  509. Escherichia coli B113 tRNA-Cys
  510. Escherichia coli B114 tRNA-Cys
  511. Escherichia coli B12:H39 tRNA-Cys
  512. Escherichia coli B12:H4 tRNA-Cys
  513. Escherichia coli B13:H16 tRNA-Cys
  514. Escherichia coli B15/O112:H1 tRNA-Cys
  515. Escherichia coli B15 tRNA-Cys
  516. Escherichia coli B171 tRNA-Cys
  517. Escherichia coli B175 tRNA-Cys
  518. Escherichia coli B17 tRNA-Cys
  519. Escherichia coli B185 tRNA-Cys
  520. Escherichia coli B26-1 tRNA-Cys
  521. Escherichia coli B26-2 tRNA-Cys
  522. Escherichia coli B28-1 tRNA-Cys
  523. Escherichia coli B28-2 tRNA-Cys
  524. Escherichia coli B29-1 tRNA-Cys
  525. Escherichia coli B29-2 tRNA-Cys
  526. Escherichia coli B2:H7 tRNA-Cys
  527. Escherichia coli B354 tRNA-Cys
  528. Escherichia coli B36-1 tRNA-Cys
  529. Escherichia coli B36-2 tRNA-Cys
  530. Escherichia coli B367 tRNA-Cys
  531. Escherichia coli B40-1 tRNA-Cys
  532. Escherichia coli B40-2 tRNA-Cys
  533. Escherichia coli B41 tRNA-Cys
  534. Escherichia coli B5-2 tRNA-Cys
  535. Escherichia coli B574 tRNA-Cys
  536. Escherichia coli B671 tRNA-Cys
  537. Escherichia coli B7-1 tRNA-Cys
  538. Escherichia coli B7-2 tRNA-Cys
  539. Escherichia coli B799 tRNA-Cys
  540. Escherichia coli B7A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  541. Escherichia coli B83 tRNA-Cys
  542. Escherichia coli B84 tRNA-Cys
  543. Escherichia coli B85 tRNA-Cys
  544. Escherichia coli B86 tRNA-Cys
  545. Escherichia coli B89 tRNA-Cys
  546. Escherichia coli B90 tRNA-Cys
  547. Escherichia coli B921 tRNA-Cys
  548. Escherichia coli B93 tRNA-Cys
  549. Escherichia coli B94 tRNA-Cys
  550. Escherichia coli B95 tRNA-Cys
  551. Escherichia coli B9:H18 tRNA-Cys
  552. Escherichia coli Bal225 tRNA-Cys
  553. Escherichia coli BCE001_MS16 tRNA-Cys
  554. Escherichia coli BCE002_MS12 tRNA-Cys
  555. Escherichia coli BCE006_MS-23 tRNA-Cys
  556. Escherichia coli BCE007_MS-11 tRNA-Cys
  557. Escherichia coli BCE008_MS-01 tRNA-Cys
  558. Escherichia coli BCE008_MS-13 tRNA-Cys
  559. Escherichia coli BCE011_MS-01 tRNA-Cys
  560. Escherichia coli BCE019_MS-13 tRNA-Cys
  561. Escherichia coli BCE030_MS-09 tRNA-Cys
  562. Escherichia coli BCE032_MS-12 tRNA-Cys
  563. Escherichia coli BCE034_MS-14 tRNA-Cys
  564. Escherichia coli Bd5610_99 tRNA-Cys
  565. Escherichia coli BIDMC 15 tRNA-Cys
  566. Escherichia coli BIDMC 17A tRNA-Cys
  567. Escherichia coli BIDMC 17B tRNA-Cys
  568. Escherichia coli BIDMC 19A tRNA-Cys
  569. Escherichia coli BIDMC 19B tRNA-Cys
  570. Escherichia coli BIDMC 19C tRNA-Cys
  571. Escherichia coli BIDMC 20A tRNA-Cys
  572. Escherichia coli BIDMC 20B tRNA-Cys
  573. Escherichia coli BIDMC 2B tRNA-Cys
  574. Escherichia coli BIDMC 37 tRNA-Cys
  575. Escherichia coli BIDMC 38 tRNA-Cys
  576. Escherichia coli BIDMC 39 tRNA-Cys
  577. Escherichia coli BIDMC 3 tRNA-Cys
  578. Escherichia coli BIDMC 43a tRNA-Cys
  579. Escherichia coli BIDMC 43b tRNA-Cys
  580. Escherichia coli BIDMC 49a tRNA-Cys
  581. Escherichia coli BIDMC 49b tRNA-Cys
  582. Escherichia coli BIDMC 58 tRNA-Cys
  583. Escherichia coli BIDMC 59 tRNA-Cys
  584. Escherichia coli BIDMC 62 tRNA-Cys
  585. Escherichia coli BIDMC 63 tRNA-Cys
  586. Escherichia coli BIDMC 64 tRNA-Cys
  587. Escherichia coli BIDMC 65 tRNA-Cys
  588. Escherichia coli BIDMC 6 tRNA-Cys
  589. Escherichia coli BIDMC 70 tRNA-Cys
  590. Escherichia coli BIDMC 71 tRNA-Cys
  591. Escherichia coli BIDMC 72 tRNA-Cys
  592. Escherichia coli BIDMC 73 tRNA-Cys
  593. Escherichia coli BIDMC 74 tRNA-Cys
  594. Escherichia coli BIDMC 75 tRNA-Cys
  595. Escherichia coli BIDMC 76 tRNA-Cys
  596. Escherichia coli BIDMC 77 tRNA-Cys
  597. Escherichia coli BIDMC 78 tRNA-Cys
  598. Escherichia coli BIDMC 79 tRNA-Cys
  599. Escherichia coli BIDMC 82 tRNA-Cys
  600. Escherichia coli BIDMC 83 tRNA-Cys
  601. Escherichia coli BIDMC 9 tRNA-Cys
  602. Escherichia coli BL21(DE3) tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  603. Escherichia coli 'BL21-Gold(DE3)pLysS AG' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  604. Escherichia coli BL21 tRNA-Cys
  605. Escherichia coli B str. REL606 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  606. Escherichia coli B tRNA-Cys
  607. Escherichia coli BW25113 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  608. Escherichia coli BW2952 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  609. Escherichia coli BWH 24 tRNA-Cys
  610. Escherichia coli BWH 32 tRNA-Cys
  611. Escherichia coli BWH 34 tRNA-Cys
  612. Escherichia coli BWH 40 tRNA-Cys
  613. Escherichia coli C-34666 tRNA-Cys
  614. Escherichia coli C691-71 (14b) tRNA-Cys
  615. Escherichia coli CAG:4 transfer RNA-Cys(GCA)
  616. Escherichia coli CB7326 tRNA-Cys
  617. Escherichia coli CD249 tRNA-Cys
  618. Escherichia coli CD311 tRNA-Cys
  619. Escherichia coli CD400 tRNA-Cys
  620. Escherichia coli CD466 tRNA-Cys
  621. Escherichia coli CD467 tRNA-Cys
  622. Escherichia coli CD471 tRNA-Cys
  623. Escherichia coli CFT073 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  624. Escherichia coli CHS 68 tRNA-Cys
  625. Escherichia coli CHS 69 tRNA-Cys
  626. Escherichia coli CHS 77 tRNA-Cys
  627. Escherichia coli C tRNA-Cys
  628. Escherichia coli CUMT8 tRNA-Cys
  629. Escherichia coli D10:H20 tRNA-Cys
  630. Escherichia coli D6-113.11 transfer RNA-Cys
  631. Escherichia coli D9 tRNA-Cys
  632. Escherichia coli DEC10A tRNA-Cys
  633. Escherichia coli DEC10B tRNA-Cys
  634. Escherichia coli DEC10C tRNA-Cys
  635. Escherichia coli DEC10D tRNA-Cys
  636. Escherichia coli DEC10E tRNA-Cys
  637. Escherichia coli DEC10F tRNA-Cys
  638. Escherichia coli DEC11A tRNA-Cys
  639. Escherichia coli DEC11B tRNA-Cys
  640. Escherichia coli DEC11C tRNA-Cys
  641. Escherichia coli DEC11D tRNA-Cys
  642. Escherichia coli DEC11E tRNA-Cys
  643. Escherichia coli DEC12A tRNA-Cys
  644. Escherichia coli DEC12B tRNA-Cys
  645. Escherichia coli DEC12C tRNA-Cys
  646. Escherichia coli DEC12D tRNA-Cys
  647. Escherichia coli DEC12E tRNA-Cys
  648. Escherichia coli DEC13A tRNA-Cys
  649. Escherichia coli DEC13B tRNA-Cys
  650. Escherichia coli DEC13C tRNA-Cys
  651. Escherichia coli DEC13D tRNA-Cys
  652. Escherichia coli DEC13E tRNA-Cys
  653. Escherichia coli DEC14A tRNA-Cys
  654. Escherichia coli DEC14B tRNA-Cys
  655. Escherichia coli DEC14C tRNA-Cys
  656. Escherichia coli DEC14D tRNA-Cys
  657. Escherichia coli DEC15A tRNA-Cys
  658. Escherichia coli DEC15B tRNA-Cys
  659. Escherichia coli DEC15C tRNA-Cys
  660. Escherichia coli DEC15D tRNA-Cys
  661. Escherichia coli DEC15E tRNA-Cys
  662. Escherichia coli DEC1A tRNA-Cys
  663. Escherichia coli DEC1B tRNA-Cys
  664. Escherichia coli DEC1C tRNA-Cys
  665. Escherichia coli DEC1D tRNA-Cys
  666. Escherichia coli DEC1E tRNA-Cys
  667. Escherichia coli DEC2A tRNA-Cys
  668. Escherichia coli DEC2B tRNA-Cys
  669. Escherichia coli DEC2C tRNA-Cys
  670. Escherichia coli DEC2D tRNA-Cys
  671. Escherichia coli DEC2E tRNA-Cys
  672. Escherichia coli DEC3A tRNA-Cys
  673. Escherichia coli DEC3B tRNA-Cys
  674. Escherichia coli DEC3C tRNA-Cys
  675. Escherichia coli DEC3D tRNA-Cys
  676. Escherichia coli DEC3E tRNA-Cys
  677. Escherichia coli DEC3F tRNA-Cys
  678. Escherichia coli DEC4A tRNA-Cys
  679. Escherichia coli DEC4B tRNA-Cys
  680. Escherichia coli DEC4C tRNA-Cys
  681. Escherichia coli DEC4D tRNA-Cys
  682. Escherichia coli DEC4E tRNA-Cys
  683. Escherichia coli DEC4F tRNA-Cys
  684. Escherichia coli DEC5A tRNA-Cys
  685. Escherichia coli DEC5B tRNA-Cys
  686. Escherichia coli DEC5C tRNA-Cys
  687. Escherichia coli DEC5D tRNA-Cys
  688. Escherichia coli DEC5E tRNA-Cys
  689. Escherichia coli DEC6A tRNA-Cys
  690. Escherichia coli DEC6B tRNA-Cys
  691. Escherichia coli DEC6C tRNA-Cys
  692. Escherichia coli DEC6D tRNA-Cys
  693. Escherichia coli DEC6E tRNA-Cys
  694. Escherichia coli DEC7A tRNA-Cys
  695. Escherichia coli DEC7B tRNA-Cys
  696. Escherichia coli DEC7C tRNA-Cys
  697. Escherichia coli DEC7D tRNA-Cys
  698. Escherichia coli DEC7E tRNA-Cys
  699. Escherichia coli DEC8A tRNA-Cys
  700. Escherichia coli DEC8B tRNA-Cys
  701. Escherichia coli DEC8C tRNA-Cys
  702. Escherichia coli DEC8D tRNA-Cys
  703. Escherichia coli DEC8E tRNA-Cys
  704. Escherichia coli DEC9A tRNA-Cys
  705. Escherichia coli DEC9B tRNA-Cys
  706. Escherichia coli DEC9C tRNA-Cys
  707. Escherichia coli DEC9D tRNA-Cys
  708. Escherichia coli DEC9E tRNA-Cys
  709. Escherichia coli DH1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  710. Escherichia coli DSM 30083 = JCM 1649 = ATCC 11775 tRNA-Cys
  711. Escherichia coli E1002 tRNA-Cys
  712. Escherichia coli E101 tRNA-Cys
  713. Escherichia coli E1114 tRNA-Cys
  714. Escherichia coli E1118 tRNA-Cys
  715. Escherichia coli E1140 tRNA-Cys
  716. Escherichia coli E1167 tRNA-Cys
  717. Escherichia coli E128010 tRNA-Cys
  718. Escherichia coli E1520 tRNA-Cys
  719. Escherichia coli E1728 tRNA-Cys
  720. Escherichia coli E22 tRNA-Cys
  721. Escherichia coli E267 tRNA-Cys
  722. Escherichia coli E482 tRNA-Cys
  723. Escherichia coli E560 tRNA-Cys
  724. Escherichia coli E704 tRNA-Cys
  725. Escherichia coli EC096/10 tRNA-Cys
  726. Escherichia coli EC1734 tRNA-Cys
  727. Escherichia coli EC1735 tRNA-Cys
  728. Escherichia coli EC1736 tRNA-Cys
  729. Escherichia coli EC1737 tRNA-Cys
  730. Escherichia coli EC1738 tRNA-Cys
  731. Escherichia coli EC1845 tRNA-Cys
  732. Escherichia coli EC1846 tRNA-Cys
  733. Escherichia coli EC1847 tRNA-Cys
  734. Escherichia coli EC1848 tRNA-Cys
  735. Escherichia coli EC1849 tRNA-Cys
  736. Escherichia coli EC1850 tRNA-Cys
  737. Escherichia coli EC1856 tRNA-Cys
  738. Escherichia coli EC1862 tRNA-Cys
  739. Escherichia coli EC1863 tRNA-Cys
  740. Escherichia coli EC1864 tRNA-Cys
  741. Escherichia coli EC1865 tRNA-Cys
  742. Escherichia coli EC1866 tRNA-Cys
  743. Escherichia coli EC1868 tRNA-Cys
  744. Escherichia coli EC1869 tRNA-Cys
  745. Escherichia coli EC1870 tRNA-Cys
  746. Escherichia coli EC4013 tRNA-Cys
  747. Escherichia coli EC4196 tRNA-Cys
  748. Escherichia coli EC4203 tRNA-Cys
  749. Escherichia coli EC4402 tRNA-Cys
  750. Escherichia coli EC4421 tRNA-Cys
  751. Escherichia coli EC4422 tRNA-Cys
  752. Escherichia coli EC4436 tRNA-Cys
  753. Escherichia coli EC4437 tRNA-Cys
  754. Escherichia coli EC4439 tRNA-Cys
  755. Escherichia coli EC4448 tRNA-Cys
  756. Escherichia coli EC96038 tRNA-Cys
  757. Escherichia coli ECA-0157 tRNA-Cys
  758. Escherichia coli ECA-727 tRNA-Cys
  759. Escherichia coli ECC-1470 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  760. Escherichia coli ECC-Z tRNA-Cys
  761. Escherichia coli ED1a tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  762. Escherichia coli Envira 10/1 tRNA-Cys
  763. Escherichia coli Envira 8/11 tRNA-Cys
  764. Escherichia coli EPECa12 tRNA-Cys
  765. Escherichia coli EPECa14 tRNA-Cys
  766. Escherichia coli EPEC C342-62 tRNA-Cys
  767. Escherichia coli ER2796 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  768. Escherichia coli ETEC H10407 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  769. Escherichia coli FAP1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  770. Escherichia coli FDA504 tRNA-Cys
  771. Escherichia coli FDA505 tRNA-Cys
  772. Escherichia coli FDA506 tRNA-Cys
  773. Escherichia coli FDA507 tRNA-Cys
  774. Escherichia coli FDA517 tRNA-Cys
  775. Escherichia coli FRIK1985 tRNA-Cys
  776. Escherichia coli FRIK1990 tRNA-Cys
  777. Escherichia coli FRIK1996 tRNA-Cys
  778. Escherichia coli FRIK1997 tRNA-Cys
  779. Escherichia coli FRIK1999 tRNA-Cys
  780. Escherichia coli FRIK2001 tRNA-Cys
  781. Escherichia coli FRIK523 tRNA-Cys
  782. Escherichia coli FRIK920 tRNA-Cys
  783. Escherichia coli FVEC1302 tRNA-Cys
  784. Escherichia coli FVEC1412 tRNA-Cys
  785. Escherichia coli FVEC1465 tRNA-Cys
  786. Escherichia coli G3/10 tRNA-Cys
  787. Escherichia coli G58-1 tRNA-Cys
  788. Escherichia coli H001 tRNA-Cys
  789. Escherichia coli :H10 tRNA-Cys
  790. Escherichia coli H120 tRNA-Cys
  791. Escherichia coli :H14 tRNA-Cys
  792. Escherichia coli :H15 tRNA-Cys
  793. Escherichia coli :H19 tRNA-Cys
  794. Escherichia coli H19 tRNA-Cys
  795. Escherichia coli H20 tRNA-Cys
  796. Escherichia coli :H21 tRNA-Cys
  797. Escherichia coli H223 tRNA-Cys
  798. Escherichia coli H252 tRNA-Cys
  799. Escherichia coli :H25 tRNA-Cys
  800. Escherichia coli H263 tRNA-Cys
  801. Escherichia coli H296 tRNA-Cys
  802. Escherichia coli H299 tRNA-Cys
  803. Escherichia coli H305 tRNA-Cys
  804. Escherichia coli H378 tRNA-Cys
  805. Escherichia coli H383 tRNA-Cys
  806. Escherichia coli H386 tRNA-Cys
  807. Escherichia coli H397 tRNA-Cys
  808. Escherichia coli H413 tRNA-Cys
  809. Escherichia coli H420 tRNA-Cys
  810. Escherichia coli H454 tRNA-Cys
  811. Escherichia coli :H45 tRNA-Cys
  812. Escherichia coli H461 tRNA-Cys
  813. Escherichia coli H489 tRNA-Cys
  814. Escherichia coli :H48 tRNA-Cys
  815. Escherichia coli H494 tRNA-Cys
  816. Escherichia coli H588 tRNA-Cys
  817. Escherichia coli H591 tRNA-Cys
  818. Escherichia coli H605 tRNA-Cys
  819. Escherichia coli H617 tRNA-Cys
  820. Escherichia coli H730 tRNA-Cys
  821. Escherichia coli H736 tRNA-Cys
  822. Escherichia coli :H7 tRNA-Cys
  823. Escherichia coli H8 tRNA-Cys
  824. Escherichia coli HM605 tRNA-Cys
  825. Escherichia coli HS tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  826. Escherichia coli HT115 tRNA-Cys
  827. Escherichia coli HVH 100 (4-2850729) tRNA-Cys
  828. Escherichia coli HVH 101 (4-6859844) tRNA-Cys
  829. Escherichia coli HVH 102 (4-6906788) (4-6906788) tRNA-Cys
  830. Escherichia coli HVH 103 (4-5904188) tRNA-Cys
  831. Escherichia coli HVH 104 (4-6977960) tRNA-Cys
  832. Escherichia coli HVH 10 (4-6832164) tRNA-Cys
  833. Escherichia coli HVH 106 (4-6881831) tRNA-Cys
  834. Escherichia coli HVH 107 (4-5860571) tRNA-Cys
  835. Escherichia coli HVH 108 (4-6924867) tRNA-Cys
  836. Escherichia coli HVH 109 (4-6977162) tRNA-Cys
  837. Escherichia coli HVH 110 (4-6978754) tRNA-Cys
  838. Escherichia coli HVH 111 (4-7039018) (4-7039018) tRNA-Cys
  839. Escherichia coli HVH 112 (4-5987253) tRNA-Cys
  840. Escherichia coli HVH 113 (4-7535473) tRNA-Cys
  841. Escherichia coli HVH 114 (4-7037740) tRNA-Cys
  842. Escherichia coli HVH 115 (4-4465989) tRNA-Cys
  843. Escherichia coli HVH 115 (4-4465997) tRNA-Cys
  844. Escherichia coli HVH 116 (4-6879942) (4-6879942) tRNA-Cys
  845. Escherichia coli HVH 117 (4-6857191) tRNA-Cys
  846. Escherichia coli HVH 118 (4-7345399) tRNA-Cys
  847. Escherichia coli HVH 119 (4-6879578) tRNA-Cys
  848. Escherichia coli HVH 120 (4-6978681) tRNA-Cys
  849. Escherichia coli HVH 121 (4-6877826) tRNA-Cys
  850. Escherichia coli HVH 122 (4-6851606) tRNA-Cys
  851. Escherichia coli HVH 12 (4-7653042) tRNA-Cys
  852. Escherichia coli HVH 125 (4-2634716) tRNA-Cys
  853. Escherichia coli HVH 126 (4-6034225) tRNA-Cys
  854. Escherichia coli HVH 127 (4-7303629) tRNA-Cys
  855. Escherichia coli HVH 128 (4-7030436) tRNA-Cys
  856. Escherichia coli HVH 130 (4-7036876) tRNA-Cys
  857. Escherichia coli HVH 132 (4-6876862) (4-6876862) tRNA-Cys
  858. Escherichia coli HVH 133 (4-4466519) tRNA-Cys
  859. Escherichia coli HVH 134 (4-6073441) tRNA-Cys
  860. Escherichia coli HVH 13 (4-7634056) tRNA-Cys
  861. Escherichia coli HVH 135 (4-4449320) tRNA-Cys
  862. Escherichia coli HVH 136 (4-5970458) (4-5970458) tRNA-Cys
  863. Escherichia coli HVH 137 (4-2124971) tRNA-Cys
  864. Escherichia coli HVH 138 (4-6066704) tRNA-Cys
  865. Escherichia coli HVH 139 (4-3192644) tRNA-Cys
  866. Escherichia coli HVH 140 (4-5894387) tRNA-Cys
  867. Escherichia coli HVH 141 (4-5995973) tRNA-Cys
  868. Escherichia coli HVH 142 (4-5627451) (4-5627451) tRNA-Cys
  869. Escherichia coli HVH 143 (4-5674999) tRNA-Cys
  870. Escherichia coli HVH 144 (4-4451937) tRNA-Cys
  871. Escherichia coli HVH 145 (4-5672112) tRNA-Cys
  872. Escherichia coli HVH 146 (4-3189767) (4-3189767) tRNA-Cys
  873. Escherichia coli HVH 1 (4-6876161) tRNA-Cys
  874. Escherichia coli HVH 147 (4-5893887) tRNA-Cys
  875. Escherichia coli HVH 148 (4-3192490) tRNA-Cys
  876. Escherichia coli HVH 149 (4-4451880) (4-4451880) tRNA-Cys
  877. Escherichia coli HVH 150 (4-3258106) tRNA-Cys
  878. Escherichia coli HVH 151 (4-5755573) tRNA-Cys
  879. Escherichia coli HVH 152 (4-3447545) tRNA-Cys
  880. Escherichia coli HVH 153 (3-9344314) (3-9344314) tRNA-Cys
  881. Escherichia coli HVH 154 (4-5636698) tRNA-Cys
  882. Escherichia coli HVH 155 (4-4509048) tRNA-Cys
  883. Escherichia coli HVH 156 (4-3206505) tRNA-Cys
  884. Escherichia coli HVH 157 (4-3406229) tRNA-Cys
  885. Escherichia coli HVH 158 (4-3224287) tRNA-Cys
  886. Escherichia coli HVH 159 (4-5818141) tRNA-Cys
  887. Escherichia coli HVH 160 (4-5695937) (4-5695937) tRNA-Cys
  888. Escherichia coli HVH 161 (4-3119890) tRNA-Cys
  889. Escherichia coli HVH 162 (4-5627982) tRNA-Cys
  890. Escherichia coli HVH 163 (4-4697553) tRNA-Cys
  891. Escherichia coli HVH 164 (4-5953081) (4-5953081) tRNA-Cys
  892. Escherichia coli HVH 16 (4-7649002) tRNA-Cys
  893. Escherichia coli HVH 167 (4-6073565) tRNA-Cys
  894. Escherichia coli HVH 169 (4-1075578) tRNA-Cys
  895. Escherichia coli HVH 170 (4-3026949) (4-3026949) tRNA-Cys
  896. Escherichia coli HVH 171 (4-3191958) (4-3191958) tRNA-Cys
  897. Escherichia coli HVH 172 (4-3248542) (4-3248542) tRNA-Cys
  898. Escherichia coli HVH 173 (3-9175482) tRNA-Cys
  899. Escherichia coli HVH 17 (4-7473087) tRNA-Cys
  900. Escherichia coli HVH 175 (4-3405184) tRNA-Cys
  901. Escherichia coli HVH 176 (4-3428664) tRNA-Cys
  902. Escherichia coli HVH 177 (4-2876612) tRNA-Cys
  903. Escherichia coli HVH 178 (4-3189163) tRNA-Cys
  904. Escherichia coli HVH 180 (4-3051617) tRNA-Cys
  905. Escherichia coli HVH 182 (4-0985554) tRNA-Cys
  906. Escherichia coli HVH 183 (4-3205932) tRNA-Cys
  907. Escherichia coli HVH 184 (4-3343286) tRNA-Cys
  908. Escherichia coli HVH 18 (4-8589585) tRNA-Cys
  909. Escherichia coli HVH 185 (4-2876639) tRNA-Cys
  910. Escherichia coli HVH 186 (4-3405044) (4-3405044) tRNA-Cys
  911. Escherichia coli HVH 187 (4-4471660) tRNA-Cys
  912. Escherichia coli HVH 188 (4-2356988) tRNA-Cys
  913. Escherichia coli HVH 189 (4-3220125) tRNA-Cys
  914. Escherichia coli HVH 190 (4-3255514) tRNA-Cys
  915. Escherichia coli HVH 191 (3-9341900) (3-9341900) tRNA-Cys
  916. Escherichia coli HVH 192 (4-3054470) (4-3054470) tRNA-Cys
  917. Escherichia coli HVH 193 (4-3331423) tRNA-Cys
  918. Escherichia coli HVH 194 (4-2356805) tRNA-Cys
  919. Escherichia coli HVH 19 (4-7154984) tRNA-Cys
  920. Escherichia coli HVH 195 (3-7155360) tRNA-Cys
  921. Escherichia coli HVH 196 (4-4530470) tRNA-Cys
  922. Escherichia coli HVH 197 (4-4466217) tRNA-Cys
  923. Escherichia coli HVH 198 (4-3206106) tRNA-Cys
  924. Escherichia coli HVH 199 (4-5670322) tRNA-Cys
  925. Escherichia coli HVH 200 (4-4449924) tRNA-Cys
  926. Escherichia coli HVH 201 (4-4459431) tRNA-Cys
  927. Escherichia coli HVH 202 (4-3163997) tRNA-Cys
  928. Escherichia coli HVH 203 (4-3126218) (4-3126218) tRNA-Cys
  929. Escherichia coli HVH 204 (4-3112802) tRNA-Cys
  930. Escherichia coli HVH 20 (4-5865042) tRNA-Cys
  931. Escherichia coli HVH 205 (4-3094677) tRNA-Cys
  932. Escherichia coli HVH 206 (4-3128229) tRNA-Cys
  933. Escherichia coli HVH 207 (4-3113221) (4-3113221) tRNA-Cys
  934. Escherichia coli HVH 208 (4-3112292) tRNA-Cys
  935. Escherichia coli HVH 209 (4-3062651) tRNA-Cys
  936. Escherichia coli HVH 210 (4-3042480) tRNA-Cys
  937. Escherichia coli HVH 211 (4-3041891) tRNA-Cys
  938. Escherichia coli HVH 212 (3-9305343) tRNA-Cys
  939. Escherichia coli HVH 213 (4-3042928) tRNA-Cys
  940. Escherichia coli HVH 214 (4-3062198) tRNA-Cys
  941. Escherichia coli HVH 21 (4-4517873) (4-4517873) tRNA-Cys
  942. Escherichia coli HVH 215 (4-3008371) tRNA-Cys
  943. Escherichia coli HVH 216 (4-3042952) tRNA-Cys
  944. Escherichia coli HVH 217 (4-1022806) tRNA-Cys
  945. Escherichia coli HVH 218 (4-4500903) tRNA-Cys
  946. Escherichia coli HVH 220 (4-5876842) (4-5876842) tRNA-Cys
  947. Escherichia coli HVH 221 (4-3136817) tRNA-Cys
  948. Escherichia coli HVH 222 (4-2977443) tRNA-Cys
  949. Escherichia coli HVH 223 (4-2976528) tRNA-Cys
  950. Escherichia coli HVH 22 (4-2258986) (4-2258986) tRNA-Cys
  951. Escherichia coli HVH 225 (4-1273116) tRNA-Cys
  952. Escherichia coli HVH 227 (4-2277670) tRNA-Cys
  953. Escherichia coli HVH 228 (4-7787030) tRNA-Cys
  954. Escherichia coli HVH 23 (4-6066488) tRNA-Cys
  955. Escherichia coli HVH 24 (4-5985145) tRNA-Cys
  956. Escherichia coli HVH 2 (4-6943160) tRNA-Cys
  957. Escherichia coli HVH 25 (4-5851939) (4-5851939) tRNA-Cys
  958. Escherichia coli HVH 26 (4-5703913) tRNA-Cys
  959. Escherichia coli HVH 27 (4-7449267) tRNA-Cys
  960. Escherichia coli HVH 28 (4-0907367) tRNA-Cys
  961. Escherichia coli HVH 29 (4-3418073) tRNA-Cys
  962. Escherichia coli HVH 30 (4-2661829) tRNA-Cys
  963. Escherichia coli HVH 31 (4-2602156) tRNA-Cys
  964. Escherichia coli HVH 32 (4-3773988) tRNA-Cys
  965. Escherichia coli HVH 33 (4-2174936) tRNA-Cys
  966. Escherichia coli HVH 3 (4-7276001) tRNA-Cys
  967. Escherichia coli HVH 35 (4-2962667) tRNA-Cys
  968. Escherichia coli HVH 36 (4-5675286) tRNA-Cys
  969. Escherichia coli HVH 37 (4-2773848) tRNA-Cys
  970. Escherichia coli HVH 38 (4-2774682) tRNA-Cys
  971. Escherichia coli HVH 39 (4-2679949) tRNA-Cys
  972. Escherichia coli HVH 40 (4-1219782) tRNA-Cys
  973. Escherichia coli HVH 41 (4-2677849) tRNA-Cys
  974. Escherichia coli HVH 42 (4-2100061) tRNA-Cys
  975. Escherichia coli HVH 43 (4-2173468) tRNA-Cys
  976. Escherichia coli HVH 44 (4-2298570) tRNA-Cys
  977. Escherichia coli HVH 4 (4-7276109) (4-7276109) tRNA-Cys
  978. Escherichia coli HVH 45 (4-3129918) tRNA-Cys
  979. Escherichia coli HVH 46 (4-2758776) tRNA-Cys
  980. Escherichia coli HVH 48 (4-2658593) tRNA-Cys
  981. Escherichia coli HVH 50 (4-2593475) tRNA-Cys
  982. Escherichia coli HVH 51 (4-2172526) tRNA-Cys
  983. Escherichia coli HVH 53 (4-0631051) tRNA-Cys
  984. Escherichia coli HVH 54 (4-2723514) tRNA-Cys
  985. Escherichia coli HVH 5 (4-7148410) tRNA-Cys
  986. Escherichia coli HVH 55 (4-2646161) tRNA-Cys
  987. Escherichia coli HVH 56 (4-2153033) tRNA-Cys
  988. Escherichia coli HVH 58 (4-2839709) tRNA-Cys
  989. Escherichia coli HVH 59 (4-1119338) tRNA-Cys
  990. Escherichia coli HVH 61 (4-2736020) tRNA-Cys
  991. Escherichia coli HVH 63 (4-2542528) tRNA-Cys
  992. Escherichia coli HVH 6 (3-8296502) (3-8296502) tRNA-Cys
  993. Escherichia coli HVH 65 (4-2262045) tRNA-Cys
  994. Escherichia coli HVH 68 (4-0888028) tRNA-Cys
  995. Escherichia coli HVH 69 (4-2837072) tRNA-Cys
  996. Escherichia coli HVH 70 (4-2963531) tRNA-Cys
  997. Escherichia coli HVH 73 (4-2393174) tRNA-Cys
  998. Escherichia coli HVH 74 (4-1034782) (4-1034782) tRNA-Cys
  999. Escherichia coli HVH 7 (4-7315031) tRNA-Cys
  1000. Escherichia coli HVH 76 (4-2538717) (4-2538717) tRNA-Cys
  1001. Escherichia coli HVH 77 (4-2605759) tRNA-Cys
  1002. Escherichia coli HVH 78 (4-2735946) tRNA-Cys
  1003. Escherichia coli HVH 79 (4-2512823) tRNA-Cys
  1004. Escherichia coli HVH 80 (4-2428830) tRNA-Cys
  1005. Escherichia coli HVH 82 (4-2209276) tRNA-Cys
  1006. Escherichia coli HVH 83 (4-2051087) tRNA-Cys
  1007. Escherichia coli HVH 84 (4-1021478) (4-1021478) tRNA-Cys
  1008. Escherichia coli HVH 85 (4-0792144) tRNA-Cys
  1009. Escherichia coli HVH 86 (4-7026218) tRNA-Cys
  1010. Escherichia coli HVH 87 (4-5977630) tRNA-Cys
  1011. Escherichia coli HVH 88 (4-5854636) tRNA-Cys
  1012. Escherichia coli HVH 89 (4-5885604) tRNA-Cys
  1013. Escherichia coli HVH 90 (4-3191362) tRNA-Cys
  1014. Escherichia coli HVH 91 (4-4638751) tRNA-Cys
  1015. Escherichia coli HVH 92 (4-5930790) tRNA-Cys
  1016. Escherichia coli HVH 93 (4-5851025) tRNA-Cys
  1017. Escherichia coli HVH 9 (4-6942539) tRNA-Cys
  1018. Escherichia coli HVH 95 (4-6074464) tRNA-Cys
  1019. Escherichia coli HVH 96 (4-5934869) tRNA-Cys
  1020. Escherichia coli HVH 98 (4-5799287) (4-5799287) tRNA-Cys
  1021. Escherichia coli IAI1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1022. Escherichia coli IAI39 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1023. Escherichia coli IHE3034 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1024. Escherichia coli J53 tRNA-Cys
  1025. Escherichia coli J96 tRNA-Cys
  1026. Escherichia coli JB1-95 tRNA-Cys
  1027. Escherichia coli JJ1886 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1028. Escherichia coli JJ1887 tRNA-Cys
  1029. Escherichia coli JJ1897 tRNA-Cys
  1030. Escherichia coli JJ1901 tRNA-Cys
  1031. Escherichia coli JJ1908 tRNA-Cys
  1032. Escherichia coli JJ1999 tRNA-Cys
  1033. Escherichia coli JJ2055 tRNA-Cys
  1034. Escherichia coli JJ2444 tRNA-Cys
  1035. Escherichia coli JJ2547 tRNA-Cys
  1036. Escherichia coli JJ2657 tRNA-Cys
  1037. Escherichia coli JJ2668 tRNA-Cys
  1038. Escherichia coli JMI268 tRNA-Cys
  1039. Escherichia coli Jurua 18/11 tRNA-Cys
  1040. Escherichia coli Jurua 20/10 tRNA-Cys
  1041. Escherichia coli K02 tRNA-Cys
  1042. Escherichia coli K71 tRNA-Cys
  1043. Escherichia coli KD1 tRNA-Cys
  1044. Escherichia coli KD2 tRNA-Cys
  1045. Escherichia coli KLY tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1046. Escherichia coli KN1604 tRNA-Cys
  1047. Escherichia coli KO11FL tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1048. Escherichia coli KOEGE 10 (25a) tRNA-Cys
  1049. Escherichia coli KOEGE 118 (317a) tRNA-Cys
  1050. Escherichia coli KOEGE 131 (358a) (358a) tRNA-Cys
  1051. Escherichia coli KOEGE 30 (63a) tRNA-Cys
  1052. Escherichia coli KOEGE 32 (66a) tRNA-Cys
  1053. Escherichia coli KOEGE 33 (68a) tRNA-Cys
  1054. Escherichia coli KOEGE 3 (4a) tRNA-Cys
  1055. Escherichia coli KOEGE 40 (102a) tRNA-Cys
  1056. Escherichia coli KOEGE 43 (105a) (105a) tRNA-Cys
  1057. Escherichia coli KOEGE 44 (106a) tRNA-Cys
  1058. Escherichia coli KOEGE 56 (169a) (169a) tRNA-Cys
  1059. Escherichia coli KOEGE 58 (171a) tRNA-Cys
  1060. Escherichia coli KOEGE 61 (174a) tRNA-Cys
  1061. Escherichia coli KOEGE 62 (175a) tRNA-Cys
  1062. Escherichia coli KOEGE 68 (182a) tRNA-Cys
  1063. Escherichia coli KOEGE 70 (185a) tRNA-Cys
  1064. Escherichia coli KOEGE 71 (186a) tRNA-Cys
  1065. Escherichia coli KOEGE 7 (16a) tRNA-Cys
  1066. Escherichia coli KOEGE 73 (195a) tRNA-Cys
  1067. Escherichia coli KOEGE 77 (202a) tRNA-Cys
  1068. Escherichia coli KTE100 tRNA-Cys
  1069. Escherichia coli KTE101 tRNA-Cys
  1070. Escherichia coli KTE102 tRNA-Cys
  1071. Escherichia coli KTE103 tRNA-Cys
  1072. Escherichia coli KTE104 tRNA-Cys
  1073. Escherichia coli KTE105 tRNA-Cys
  1074. Escherichia coli KTE106 tRNA-Cys
  1075. Escherichia coli KTE107 tRNA-Cys
  1076. Escherichia coli KTE108 tRNA-Cys
  1077. Escherichia coli KTE109 tRNA-Cys
  1078. Escherichia coli KTE10 tRNA-Cys
  1079. Escherichia coli KTE111 tRNA-Cys
  1080. Escherichia coli KTE112 tRNA-Cys
  1081. Escherichia coli KTE113 tRNA-Cys
  1082. Escherichia coli KTE115 tRNA-Cys
  1083. Escherichia coli KTE116 tRNA-Cys
  1084. Escherichia coli KTE117 tRNA-Cys
  1085. Escherichia coli KTE118 tRNA-Cys
  1086. Escherichia coli KTE119 tRNA-Cys
  1087. Escherichia coli KTE120 tRNA-Cys
  1088. Escherichia coli KTE121 tRNA-Cys
  1089. Escherichia coli KTE122 tRNA-Cys
  1090. Escherichia coli KTE123 tRNA-Cys
  1091. Escherichia coli KTE124 tRNA-Cys
  1092. Escherichia coli KTE125 tRNA-Cys
  1093. Escherichia coli KTE126 tRNA-Cys
  1094. Escherichia coli KTE127 tRNA-Cys
  1095. Escherichia coli KTE128 tRNA-Cys
  1096. Escherichia coli KTE129 tRNA-Cys
  1097. Escherichia coli KTE12 tRNA-Cys
  1098. Escherichia coli KTE130 tRNA-Cys
  1099. Escherichia coli KTE131 tRNA-Cys
  1100. Escherichia coli KTE132 tRNA-Cys
  1101. Escherichia coli KTE133 tRNA-Cys
  1102. Escherichia coli KTE134 tRNA-Cys
  1103. Escherichia coli KTE135 tRNA-Cys
  1104. Escherichia coli KTE136 tRNA-Cys
  1105. Escherichia coli KTE137 tRNA-Cys
  1106. Escherichia coli KTE138 tRNA-Cys
  1107. Escherichia coli KTE139 tRNA-Cys
  1108. Escherichia coli KTE13 tRNA-Cys
  1109. Escherichia coli KTE140 tRNA-Cys
  1110. Escherichia coli KTE141 tRNA-Cys
  1111. Escherichia coli KTE142 tRNA-Cys
  1112. Escherichia coli KTE143 tRNA-Cys
  1113. Escherichia coli KTE144 tRNA-Cys
  1114. Escherichia coli KTE145 tRNA-Cys
  1115. Escherichia coli KTE146 tRNA-Cys
  1116. Escherichia coli KTE147 tRNA-Cys
  1117. Escherichia coli KTE148 tRNA-Cys
  1118. Escherichia coli KTE14 tRNA-Cys
  1119. Escherichia coli KTE150 tRNA-Cys
  1120. Escherichia coli KTE153 tRNA-Cys
  1121. Escherichia coli KTE154 tRNA-Cys
  1122. Escherichia coli KTE155 tRNA-Cys
  1123. Escherichia coli KTE156 tRNA-Cys
  1124. Escherichia coli KTE157 tRNA-Cys
  1125. Escherichia coli KTE158 tRNA-Cys
  1126. Escherichia coli KTE15 tRNA-Cys
  1127. Escherichia coli KTE160 tRNA-Cys
  1128. Escherichia coli KTE161 tRNA-Cys
  1129. Escherichia coli KTE162 tRNA-Cys
  1130. Escherichia coli KTE163 tRNA-Cys
  1131. Escherichia coli KTE165 tRNA-Cys
  1132. Escherichia coli KTE166 tRNA-Cys
  1133. Escherichia coli KTE167 tRNA-Cys
  1134. Escherichia coli KTE168 tRNA-Cys
  1135. Escherichia coli KTE169 tRNA-Cys
  1136. Escherichia coli KTE16 tRNA-Cys
  1137. Escherichia coli KTE170 tRNA-Cys
  1138. Escherichia coli KTE171 tRNA-Cys
  1139. Escherichia coli KTE173 tRNA-Cys
  1140. Escherichia coli KTE174 tRNA-Cys
  1141. Escherichia coli KTE175 tRNA-Cys
  1142. Escherichia coli KTE176 tRNA-Cys
  1143. Escherichia coli KTE177 tRNA-Cys
  1144. Escherichia coli KTE178 tRNA-Cys
  1145. Escherichia coli KTE179 tRNA-Cys
  1146. Escherichia coli KTE17 tRNA-Cys
  1147. Escherichia coli KTE180 tRNA-Cys
  1148. Escherichia coli KTE181 tRNA-Cys
  1149. Escherichia coli KTE182 tRNA-Cys
  1150. Escherichia coli KTE183 tRNA-Cys
  1151. Escherichia coli KTE184 tRNA-Cys
  1152. Escherichia coli KTE185 tRNA-Cys
  1153. Escherichia coli KTE186 tRNA-Cys
  1154. Escherichia coli KTE187 tRNA-Cys
  1155. Escherichia coli KTE188 tRNA-Cys
  1156. Escherichia coli KTE189 tRNA-Cys
  1157. Escherichia coli KTE18 tRNA-Cys
  1158. Escherichia coli KTE190 tRNA-Cys
  1159. Escherichia coli KTE191 tRNA-Cys
  1160. Escherichia coli KTE192 tRNA-Cys
  1161. Escherichia coli KTE193 tRNA-Cys
  1162. Escherichia coli KTE194 tRNA-Cys
  1163. Escherichia coli KTE195 tRNA-Cys
  1164. Escherichia coli KTE196 tRNA-Cys
  1165. Escherichia coli KTE197 tRNA-Cys
  1166. Escherichia coli KTE198 tRNA-Cys
  1167. Escherichia coli KTE199 tRNA-Cys
  1168. Escherichia coli KTE19 tRNA-Cys
  1169. Escherichia coli KTE1 tRNA-Cys
  1170. Escherichia coli KTE200 tRNA-Cys
  1171. Escherichia coli KTE201 tRNA-Cys
  1172. Escherichia coli KTE202 tRNA-Cys
  1173. Escherichia coli KTE203 tRNA-Cys
  1174. Escherichia coli KTE204 tRNA-Cys
  1175. Escherichia coli KTE205 tRNA-Cys
  1176. Escherichia coli KTE206 tRNA-Cys
  1177. Escherichia coli KTE207 tRNA-Cys
  1178. Escherichia coli KTE208 tRNA-Cys
  1179. Escherichia coli KTE209 tRNA-Cys
  1180. Escherichia coli KTE20 tRNA-Cys
  1181. Escherichia coli KTE210 tRNA-Cys
  1182. Escherichia coli KTE211 tRNA-Cys
  1183. Escherichia coli KTE212 tRNA-Cys
  1184. Escherichia coli KTE213 tRNA-Cys
  1185. Escherichia coli KTE214 tRNA-Cys
  1186. Escherichia coli KTE215 tRNA-Cys
  1187. Escherichia coli KTE216 tRNA-Cys
  1188. Escherichia coli KTE217 tRNA-Cys
  1189. Escherichia coli KTE218 tRNA-Cys
  1190. Escherichia coli KTE219 tRNA-Cys
  1191. Escherichia coli KTE21 tRNA-Cys
  1192. Escherichia coli KTE220 tRNA-Cys
  1193. Escherichia coli KTE221 tRNA-Cys
  1194. Escherichia coli KTE222 tRNA-Cys
  1195. Escherichia coli KTE223 tRNA-Cys
  1196. Escherichia coli KTE224 tRNA-Cys
  1197. Escherichia coli KTE225 tRNA-Cys
  1198. Escherichia coli KTE226 tRNA-Cys
  1199. Escherichia coli KTE227 tRNA-Cys
  1200. Escherichia coli KTE228 tRNA-Cys
  1201. Escherichia coli KTE229 tRNA-Cys
  1202. Escherichia coli KTE22 tRNA-Cys
  1203. Escherichia coli KTE230 tRNA-Cys
  1204. Escherichia coli KTE231 tRNA-Cys
  1205. Escherichia coli KTE232 tRNA-Cys
  1206. Escherichia coli KTE233 tRNA-Cys
  1207. Escherichia coli KTE234 tRNA-Cys
  1208. Escherichia coli KTE235 tRNA-Cys
  1209. Escherichia coli KTE236 tRNA-Cys
  1210. Escherichia coli KTE237 tRNA-Cys
  1211. Escherichia coli KTE23 tRNA-Cys
  1212. Escherichia coli KTE240 tRNA-Cys
  1213. Escherichia coli KTE24 tRNA-Cys
  1214. Escherichia coli KTE25 tRNA-Cys
  1215. Escherichia coli KTE26 tRNA-Cys
  1216. Escherichia coli KTE27 tRNA-Cys
  1217. Escherichia coli KTE28 tRNA-Cys
  1218. Escherichia coli KTE29 tRNA-Cys
  1219. Escherichia coli KTE2 tRNA-Cys
  1220. Escherichia coli KTE33 tRNA-Cys
  1221. Escherichia coli KTE34 tRNA-Cys
  1222. Escherichia coli KTE35 tRNA-Cys
  1223. Escherichia coli KTE36 tRNA-Cys
  1224. Escherichia coli KTE37 tRNA-Cys
  1225. Escherichia coli KTE38 tRNA-Cys
  1226. Escherichia coli KTE39 tRNA-Cys
  1227. Escherichia coli KTE3 tRNA-Cys
  1228. Escherichia coli KTE40 tRNA-Cys
  1229. Escherichia coli KTE41 tRNA-Cys
  1230. Escherichia coli KTE42 tRNA-Cys
  1231. Escherichia coli KTE43 tRNA-Cys
  1232. Escherichia coli KTE44 tRNA-Cys
  1233. Escherichia coli KTE45 tRNA-Cys
  1234. Escherichia coli KTE46 tRNA-Cys
  1235. Escherichia coli KTE47 tRNA-Cys
  1236. Escherichia coli KTE48 tRNA-Cys
  1237. Escherichia coli KTE49 tRNA-Cys
  1238. Escherichia coli KTE4 tRNA-Cys
  1239. Escherichia coli KTE50 tRNA-Cys
  1240. Escherichia coli KTE51 tRNA-Cys
  1241. Escherichia coli KTE53 tRNA-Cys
  1242. Escherichia coli KTE54 tRNA-Cys
  1243. Escherichia coli KTE55 tRNA-Cys
  1244. Escherichia coli KTE56 tRNA-Cys
  1245. Escherichia coli KTE57 tRNA-Cys
  1246. Escherichia coli KTE58 tRNA-Cys
  1247. Escherichia coli KTE59 tRNA-Cys
  1248. Escherichia coli KTE5 tRNA-Cys
  1249. Escherichia coli KTE60 tRNA-Cys
  1250. Escherichia coli KTE61 tRNA-Cys
  1251. Escherichia coli KTE62 tRNA-Cys
  1252. Escherichia coli KTE63 tRNA-Cys
  1253. Escherichia coli KTE64 tRNA-Cys
  1254. Escherichia coli KTE65 tRNA-Cys
  1255. Escherichia coli KTE66 tRNA-Cys
  1256. Escherichia coli KTE67 tRNA-Cys
  1257. Escherichia coli KTE68 tRNA-Cys
  1258. Escherichia coli KTE69 tRNA-Cys
  1259. Escherichia coli KTE6 tRNA-Cys
  1260. Escherichia coli KTE70 tRNA-Cys
  1261. Escherichia coli KTE71 tRNA-Cys
  1262. Escherichia coli KTE72 tRNA-Cys
  1263. Escherichia coli KTE73 tRNA-Cys
  1264. Escherichia coli KTE74 tRNA-Cys
  1265. Escherichia coli KTE75 tRNA-Cys
  1266. Escherichia coli KTE76 tRNA-Cys
  1267. Escherichia coli KTE77 tRNA-Cys
  1268. Escherichia coli KTE78 tRNA-Cys
  1269. Escherichia coli KTE79 tRNA-Cys
  1270. Escherichia coli KTE7 tRNA-Cys
  1271. Escherichia coli KTE80 tRNA-Cys
  1272. Escherichia coli KTE81 tRNA-Cys
  1273. Escherichia coli KTE82 tRNA-Cys
  1274. Escherichia coli KTE83 tRNA-Cys
  1275. Escherichia coli KTE84 tRNA-Cys
  1276. Escherichia coli KTE85 tRNA-Cys
  1277. Escherichia coli KTE86 tRNA-Cys
  1278. Escherichia coli KTE87 tRNA-Cys
  1279. Escherichia coli KTE88 tRNA-Cys
  1280. Escherichia coli KTE89 tRNA-Cys
  1281. Escherichia coli KTE8 tRNA-Cys
  1282. Escherichia coli KTE90 tRNA-Cys
  1283. Escherichia coli KTE91 tRNA-Cys
  1284. Escherichia coli KTE93 tRNA-Cys
  1285. Escherichia coli KTE94 tRNA-Cys
  1286. Escherichia coli KTE95 tRNA-Cys
  1287. Escherichia coli KTE97 tRNA-Cys
  1288. Escherichia coli KTE98 tRNA-Cys
  1289. Escherichia coli KTE99 tRNA-Cys
  1290. Escherichia coli KTE9 tRNA-Cys
  1291. Escherichia coli LAU-EC10 tRNA-Cys
  1292. Escherichia coli LAU-EC6 tRNA-Cys
  1293. Escherichia coli LAU-EC7 tRNA-Cys
  1294. Escherichia coli LAU-EC8 tRNA-Cys
  1295. Escherichia coli LAU-EC9 tRNA-Cys
  1296. Escherichia coli LF82 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1297. Escherichia coli LT-68 tRNA-Cys
  1298. Escherichia coli LY180 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1299. Escherichia coli M056 tRNA-Cys
  1300. Escherichia coli M114 tRNA-Cys
  1301. Escherichia coli M12 tRNA-Cys
  1302. Escherichia coli M4 tRNA-Cys
  1303. Escherichia coli M605 tRNA-Cys
  1304. Escherichia coli M718 tRNA-Cys
  1305. Escherichia coli M863 tRNA-Cys
  1306. Escherichia coli M8 tRNA-Cys
  1307. Escherichia coli M919 tRNA-Cys
  1308. Escherichia coli MA6 tRNA-Cys
  1309. Escherichia coli MGH 57 tRNA-Cys
  1310. Escherichia coli MGH 58 tRNA-Cys
  1311. Escherichia coli MH5800 tRNA-Cys
  1312. Escherichia coli MP020940.1 tRNA-Cys
  1313. Escherichia coli MP020980.1 tRNA-Cys
  1314. Escherichia coli MP020980.2 tRNA-Cys
  1315. Escherichia coli MP021017.10 tRNA-Cys
  1316. Escherichia coli MP021017.11 tRNA-Cys
  1317. Escherichia coli MP021017.12 tRNA-Cys
  1318. Escherichia coli MP021017.1 tRNA-Cys
  1319. Escherichia coli MP021017.2 tRNA-Cys
  1320. Escherichia coli MP021017.3 tRNA-Cys
  1321. Escherichia coli MP021017.4 tRNA-Cys
  1322. Escherichia coli MP021017.5 tRNA-Cys
  1323. Escherichia coli MP021017.6 tRNA-Cys
  1324. Escherichia coli MP021017.9 tRNA-Cys
  1325. Escherichia coli MP021552.11 tRNA-Cys
  1326. Escherichia coli MP021552.12 tRNA-Cys
  1327. Escherichia coli MP021552.7 tRNA-Cys
  1328. Escherichia coli MP021552.8 tRNA-Cys
  1329. Escherichia coli MP021561.2 tRNA-Cys
  1330. Escherichia coli MP021561.3 tRNA-Cys
  1331. Escherichia coli MP021566.1 tRNA-Cys
  1332. Escherichia coli MP1 tRNA-Cys
  1333. Escherichia coli MRSN 10204 tRNA-Cys
  1334. Escherichia coli MS 107-1 tRNA-Cys
  1335. Escherichia coli MS 110-3 tRNA-Cys
  1336. Escherichia coli MS 115-1 tRNA-Cys
  1337. Escherichia coli MS 116-1 tRNA-Cys
  1338. Escherichia coli MS 117-3 tRNA-Cys
  1339. Escherichia coli MS 119-7 tRNA-Cys
  1340. Escherichia coli MS 124-1 tRNA-Cys
  1341. Escherichia coli MS 145-7 tRNA-Cys
  1342. Escherichia coli MS 146-1 tRNA-Cys
  1343. Escherichia coli MS 153-1 tRNA-Cys
  1344. Escherichia coli MS 16-3 tRNA-Cys
  1345. Escherichia coli MS 175-1 tRNA-Cys
  1346. Escherichia coli MS 182-1 tRNA-Cys
  1347. Escherichia coli MS 185-1 tRNA-Cys
  1348. Escherichia coli MS 187-1 tRNA-Cys
  1349. Escherichia coli MS 196-1 tRNA-Cys
  1350. Escherichia coli MS 198-1 tRNA-Cys
  1351. Escherichia coli MS 200-1 tRNA-Cys
  1352. Escherichia coli MS 21-1 tRNA-Cys
  1353. Escherichia coli MS 45-1 tRNA-Cys
  1354. Escherichia coli MS 57-2 tRNA-Cys
  1355. Escherichia coli MS 60-1 tRNA-Cys
  1356. Escherichia coli MS 69-1 tRNA-Cys
  1357. Escherichia coli MS 78-1 tRNA-Cys
  1358. Escherichia coli MS 79-10 tRNA-Cys
  1359. Escherichia coli MS 84-1 tRNA-Cys
  1360. Escherichia coli MS 85-1 tRNA-Cys
  1361. Escherichia coli MVAST020 tRNA-Cys
  1362. Escherichia coli MVAST084 tRNA-Cys
  1363. Escherichia coli MVAST131 tRNA-Cys
  1364. Escherichia coli MVAST167 tRNA-Cys
  1365. Escherichia coli N1 tRNA-Cys
  1366. Escherichia coli N36254PS tRNA-Cys
  1367. Escherichia coli N36410PS tRNA-Cys
  1368. Escherichia coli N37058PS tRNA-Cys
  1369. Escherichia coli N37122PS tRNA-Cys
  1370. Escherichia coli N37139PS tRNA-Cys
  1371. Escherichia coli N40513 tRNA-Cys
  1372. Escherichia coli N40607 tRNA-Cys
  1373. Escherichia coli NA114 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1374. Escherichia coli NB8 tRNA-Cys
  1375. Escherichia coli NC101 tRNA-Cys
  1376. Escherichia coli NCCP15648 tRNA-Cys
  1377. Escherichia coli NCTC 50110 tRNA-Cys
  1378. Escherichia coli NE037 tRNA-Cys
  1379. Escherichia coli NE098 tRNA-Cys
  1380. Escherichia coli NE1487 tRNA-Cys
  1381. Escherichia coli Nissle 1917 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1382. Escherichia coli NU14 tRNA-Cys
  1383. Escherichia coli O08 tRNA-Cys
  1384. Escherichia coli O100:H12 tRNA-Cys
  1385. Escherichia coli O100:H21 tRNA-Cys
  1386. Escherichia coli O100 tRNA-Cys
  1387. Escherichia coli O101 tRNA-Cys
  1388. Escherichia coli O102:H6 tRNA-Cys
  1389. Escherichia coli O102 tRNA-Cys
  1390. Escherichia coli O103:H11 str. 04-3023 tRNA-Cys
  1391. Escherichia coli O103:H11 str. 2010C-3214 tRNA-Cys
  1392. Escherichia coli O103:H25 str. 2010C-4529 tRNA-Cys
  1393. Escherichia coli O103:H25 str. CVM9340 tRNA-Cys
  1394. Escherichia coli O103:H2 str. 12009 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1395. Escherichia coli O103:H2 str. 2009C-3279 tRNA-Cys
  1396. Escherichia coli O103:H2 str. 2010C-4433 tRNA-Cys
  1397. Escherichia coli O103:H2 str. 2011C-3750 tRNA-Cys
  1398. Escherichia coli O103:H2 str. CVM9450 tRNA-Cys
  1399. Escherichia coli O103:H2 tRNA-Cys
  1400. Escherichia coli O103:H43 tRNA-Cys
  1401. Escherichia coli O103 str. RM8385 tRNA-Cys
  1402. Escherichia coli O103 tRNA-Cys
  1403. Escherichia coli O104:H21 str. 94-3025 tRNA-Cys
  1404. Escherichia coli O104:H21 str. CFSAN002236 tRNA-Cys
  1405. Escherichia coli O104:H21 str. CFSAN002237 tRNA-Cys
  1406. Escherichia coli O104:H4 str. 01-09591 tRNA-Cys
  1407. Escherichia coli O104:H4 str. 04-8351 tRNA-Cys
  1408. Escherichia coli O104:H4 str. 09-7901 tRNA-Cys
  1409. Escherichia coli O104:H4 str. 11-02030 tRNA-Cys
  1410. Escherichia coli O104:H4 str. 11-02033-1 tRNA-Cys
  1411. Escherichia coli O104:H4 str. 11-02092 tRNA-Cys
  1412. Escherichia coli O104:H4 str. 11-02093 tRNA-Cys
  1413. Escherichia coli O104:H4 str. 11-02281 tRNA-Cys
  1414. Escherichia coli O104:H4 str. 11-02318 tRNA-Cys
  1415. Escherichia coli O104:H4 str. 11-02913 tRNA-Cys
  1416. Escherichia coli O104:H4 str. 11-03439 tRNA-Cys
  1417. Escherichia coli O104:H4 str. 11-03943 tRNA-Cys
  1418. Escherichia coli O104:H4 str. 11-04080 tRNA-Cys
  1419. Escherichia coli O104:H4 str. 11-3677 tRNA-Cys
  1420. Escherichia coli O104:H4 str. 11-4404 tRNA-Cys
  1421. Escherichia coli O104:H4 str. 11-4522 tRNA-Cys
  1422. Escherichia coli O104:H4 str. 11-4623 tRNA-Cys
  1423. Escherichia coli O104:H4 str. 11-4632 C1 tRNA-Cys
  1424. Escherichia coli O104:H4 str. 11-4632 C2 tRNA-Cys
  1425. Escherichia coli O104:H4 str. 11-4632 C3 tRNA-Cys
  1426. Escherichia coli O104:H4 str. 11-4632 C4 tRNA-Cys
  1427. Escherichia coli O104:H4 str. 11-4632 C5 tRNA-Cys
  1428. Escherichia coli O104:H4 str. 2009EL-2050 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1429. Escherichia coli O104:H4 str. 2009EL-2071 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1430. Escherichia coli O104:H4 str. 2011C-3493 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1431. Escherichia coli O104:H4 str. 2011EL-1675A tRNA-Cys
  1432. Escherichia coli O104:H4 str. C227-11 tRNA-Cys
  1433. Escherichia coli O104:H4 str. C236-11 tRNA-Cys
  1434. Escherichia coli O104:H4 str. E112/10 tRNA-Cys
  1435. Escherichia coli O104:H4 str. E92/11 tRNA-Cys
  1436. Escherichia coli O104:H4 str. Ec11-4984 tRNA-Cys
  1437. Escherichia coli O104:H4 str. Ec11-4986 tRNA-Cys
  1438. Escherichia coli O104:H4 str. Ec11-4987 tRNA-Cys
  1439. Escherichia coli O104:H4 str. Ec11-4988 tRNA-Cys
  1440. Escherichia coli O104:H4 str. Ec11-5603 tRNA-Cys
  1441. Escherichia coli O104:H4 str. Ec11-5604 tRNA-Cys
  1442. Escherichia coli O104:H4 str. Ec11-6006 tRNA-Cys
  1443. Escherichia coli O104:H4 str. Ec11-9450 tRNA-Cys
  1444. Escherichia coli O104:H4 str. Ec11-9941 tRNA-Cys
  1445. Escherichia coli O104:H4 str. Ec11-9990 tRNA-Cys
  1446. Escherichia coli O104:H4 str. Ec12-0465 tRNA-Cys
  1447. Escherichia coli O104:H4 str. Ec12-0466 tRNA-Cys
  1448. Escherichia coli O104:H4 str. LB226692 tRNA-Cys
  1449. Escherichia coli O104:H4 tRNA-Cys
  1450. Escherichia coli O104:H7 tRNA-Cys
  1451. Escherichia coli O104 tRNA-Cys
  1452. Escherichia coli O105:H7 tRNA-Cys
  1453. Escherichia coli O105 tRNA-Cys
  1454. Escherichia coli O106 tRNA-Cys
  1455. Escherichia coli O107 tRNA-Cys
  1456. Escherichia coli O108:H9 tRNA-Cys
  1457. Escherichia coli O109 tRNA-Cys
  1458. Escherichia coli O10:H32 tRNA-Cys
  1459. Escherichia coli O10:K5(L):H4 str. ATCC 23506 tRNA-Cys-GCA
  1460. Escherichia coli O10 tRNA-Cys
  1461. Escherichia coli O110:H10 tRNA-Cys
  1462. Escherichia coli O110 tRNA-Cys
  1463. Escherichia coli O111:H11 str. CFSAN001630 tRNA-Cys
  1464. Escherichia coli O111:H11 str. CVM9455 tRNA-Cys
  1465. Escherichia coli O111:H11 str. CVM9534 tRNA-Cys
  1466. Escherichia coli O111:H11 str. CVM9545 tRNA-Cys
  1467. Escherichia coli O111:H11 str. CVM9553 tRNA-Cys
  1468. Escherichia coli O111:H8 str. 2009C-4126 tRNA-Cys
  1469. Escherichia coli O111:H8 str. 2009EL-2169 tRNA-Cys
  1470. Escherichia coli O111:H8 str. 2011C-3453 tRNA-Cys
  1471. Escherichia coli O111:H8 str. CFSAN001632 tRNA-Cys
  1472. Escherichia coli O111:H8 str. CVM9570 tRNA-Cys
  1473. Escherichia coli O111:H8 str. CVM9574 tRNA-Cys
  1474. Escherichia coli O111:H8 str. CVM9602 tRNA-Cys
  1475. Escherichia coli O111:H8 str. CVM9634 tRNA-Cys
  1476. Escherichia coli O111:H8 str. F6627 tRNA-Cys
  1477. Escherichia coli O111:H8 tRNA-Cys
  1478. Escherichia coli O111:H- str. 11128 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1479. Escherichia coli O111:H- tRNA-Cys (GCA)
  1480. Escherichia coli O111:NM str. 01-3076 tRNA-Cys
  1481. Escherichia coli O111:NM str. 03-3484 tRNA-Cys
  1482. Escherichia coli O111:NM str. 04-3211 tRNA-Cys
  1483. Escherichia coli O111:NM str. 08-4487 tRNA-Cys
  1484. Escherichia coli O111:NM str. 2009C-4006 tRNA-Cys
  1485. Escherichia coli O111:NM str. 2009C-4052 tRNA-Cys
  1486. Escherichia coli O111:NM str. 2010C-3053 tRNA-Cys
  1487. Escherichia coli O111:NM str. 2010C-3977 tRNA-Cys
  1488. Escherichia coli O111:NM str. 2010C-4086 tRNA-Cys
  1489. Escherichia coli O111:NM str. 2010C-4221 tRNA-Cys
  1490. Escherichia coli O111:NM str. 2010C-4592 tRNA-Cys
  1491. Escherichia coli O111:NM str. 2010C-4622 tRNA-Cys
  1492. Escherichia coli O111:NM str. 2010C-4715 tRNA-Cys
  1493. Escherichia coli O111:NM str. 2010C-4735 tRNA-Cys
  1494. Escherichia coli O111:NM str. 2010C-4746 tRNA-Cys
  1495. Escherichia coli O111:NM str. 2010C-4799 tRNA-Cys
  1496. Escherichia coli O111:NM str. 2010C-4818 tRNA-Cys
  1497. Escherichia coli O111:NM str. 2011C-3170 tRNA-Cys
  1498. Escherichia coli O111:NM str. 2011C-3362 tRNA-Cys
  1499. Escherichia coli O111:NM str. 2011C-3573 tRNA-Cys
  1500. Escherichia coli O111:NM str. 2011C-3632 tRNA-Cys
  1501. Escherichia coli O111:NM str. 2011C-3679 tRNA-Cys
  1502. Escherichia coli O111:NM str. K6722 tRNA-Cys
  1503. Escherichia coli O111:NM str. K6723 tRNA-Cys
  1504. Escherichia coli O111:NM str. K6728 tRNA-Cys
  1505. Escherichia coli O111:NM str. K6890 tRNA-Cys
  1506. Escherichia coli O111:NM str. K6895 tRNA-Cys
  1507. Escherichia coli O111:NM str. K6897 tRNA-Cys
  1508. Escherichia coli O111:NM str. K6898 tRNA-Cys
  1509. Escherichia coli O111:NM str. K6904 tRNA-Cys
  1510. Escherichia coli O111:NM str. K6908 tRNA-Cys
  1511. Escherichia coli O111:NM str. K6915 tRNA-Cys
  1512. Escherichia coli O111:NM tRNA-Cys
  1513. Escherichia coli O111 str. RM9322 tRNA-Cys
  1514. Escherichia coli O111 tRNA-Cys
  1515. Escherichia coli O112ab:H8 tRNA-Cys
  1516. Escherichia coli O113:H21 str. 07-4224 tRNA-Cys
  1517. Escherichia coli O113:H21 tRNA-Cys
  1518. Escherichia coli O113:H36 tRNA-Cys
  1519. Escherichia coli O113:H4 tRNA-Cys
  1520. Escherichia coli O113 tRNA-Cys
  1521. Escherichia coli O113w tRNA-Cys
  1522. Escherichia coli O116 tRNA-Cys
  1523. Escherichia coli O117 tRNA-Cys
  1524. Escherichia coli O118:H16 str. 06-3256 tRNA-Cys
  1525. Escherichia coli O118:H16 str. 06-3612 tRNA-Cys
  1526. Escherichia coli O118:H16 str. 07-4255 tRNA-Cys
  1527. Escherichia coli O118:H16 str. 08-3651 tRNA-Cys
  1528. Escherichia coli O118:H16 str. 2009C-4446 tRNA-Cys
  1529. Escherichia coli O119:H4 str. 03-3458 tRNA-Cys
  1530. Escherichia coli O119 tRNA-Cys
  1531. Escherichia coli O11:H15 tRNA-Cys
  1532. Escherichia coli O11 tRNA-Cys
  1533. Escherichia coli O120:H10 tRNA-Cys
  1534. Escherichia coli O120:H1 tRNA-Cys
  1535. Escherichia coli O120:H4 tRNA-Cys
  1536. Escherichia coli O121:H19 str. 03-3227 tRNA-Cys
  1537. Escherichia coli O121:H19 str. 06-3003 tRNA-Cys
  1538. Escherichia coli O121:H19 str. 06-3822 tRNA-Cys
  1539. Escherichia coli O121:H19 str. 2009C-4050 tRNA-Cys
  1540. Escherichia coli O121:H19 str. 2009C-4659 tRNA-Cys
  1541. Escherichia coli O121:H19 str. 2009C-4750 tRNA-Cys
  1542. Escherichia coli O121:H19 str. 2009EL1302 tRNA-Cys
  1543. Escherichia coli O121:H19 str. 2009EL1412 tRNA-Cys
  1544. Escherichia coli O121:H19 str. 2010C-3609 tRNA-Cys
  1545. Escherichia coli O121:H19 str. 2010C-3794 tRNA-Cys
  1546. Escherichia coli O121:H19 str. 2010C-3840 tRNA-Cys
  1547. Escherichia coli O121:H19 str. 2010C-4254 tRNA-Cys
  1548. Escherichia coli O121:H19 str. 2010C-4732 tRNA-Cys
  1549. Escherichia coli O121:H19 str. 2010C-4824 tRNA-Cys
  1550. Escherichia coli O121:H19 str. 2010C-4966 tRNA-Cys
  1551. Escherichia coli O121:H19 str. 2010C-4989 tRNA-Cys
  1552. Escherichia coli O121:H19 str. 2010EL1058 tRNA-Cys
  1553. Escherichia coli O121:H19 str. 2011C-3072 tRNA-Cys
  1554. Escherichia coli O121:H19 str. 2011C-3108 tRNA-Cys
  1555. Escherichia coli O121:H19 str. 2011C-3216 tRNA-Cys
  1556. Escherichia coli O121:H19 str. 2011C-3500 tRNA-Cys
  1557. Escherichia coli O121:H19 str. 2011C-3537 tRNA-Cys
  1558. Escherichia coli O121:H19 str. 2011C-3609 tRNA-Cys
  1559. Escherichia coli O121:H19 str. F6714 tRNA-Cys
  1560. Escherichia coli O121:H19 str. K5198 tRNA-Cys
  1561. Escherichia coli O121:H19 str. K5269 tRNA-Cys
  1562. Escherichia coli O121:H19 tRNA-Cys
  1563. Escherichia coli O121:H7 str. 2009C-3299 tRNA-Cys
  1564. Escherichia coli O121 str. RM8352 tRNA-Cys
  1565. Escherichia coli O121 tRNA-Cys
  1566. Escherichia coli O123:H11 str. 2009C-3307 tRNA-Cys
  1567. Escherichia coli O124 tRNA-Cys
  1568. Escherichia coli O125ac:K+:H10 tRNA-Cys
  1569. Escherichia coli O126:H19 tRNA-Cys
  1570. Escherichia coli O126:H45 tRNA-Cys
  1571. Escherichia coli O126 tRNA-Cys
  1572. Escherichia coli O127:H27 str. C43/90 tRNA-Cys
  1573. Escherichia coli O127:H6 str. E2348/69 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1574. Escherichia coli O127:H6 tRNA-Cys
  1575. Escherichia coli O128AB:H2 tRNA-Cys
  1576. Escherichia coli O128ac:H12 tRNA-Cys
  1577. Escherichia coli O128AC:H2 tRNA-Cys
  1578. Escherichia coli O128:H2 str. 2011C-3317 tRNA-Cys
  1579. Escherichia coli O128:H2 tRNA-Cys
  1580. Escherichia coli O128:H42 tRNA-Cys
  1581. Escherichia coli O128 tRNA-Cys
  1582. Escherichia coli O130 tRNA-Cys
  1583. Escherichia coli O132 tRNA-Cys
  1584. Escherichia coli O133:H29 tRNA-Cys
  1585. Escherichia coli O134:H31 tRNA-Cys
  1586. Escherichia coli O136:H26 tRNA-Cys
  1587. Escherichia coli O139:H1 tRNA-Cys
  1588. Escherichia coli O139:H28 str. E24377A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1589. Escherichia coli O13:H15 tRNA-Cys
  1590. Escherichia coli O13:H4 tRNA-Cys
  1591. Escherichia coli O13 tRNA-Cys
  1592. Escherichia coli O140:H14 tRNA-Cys
  1593. Escherichia coli O140 tRNA-Cys
  1594. Escherichia coli O141:H4 tRNA-Cys
  1595. Escherichia coli O143:H4 tRNA-Cys
  1596. Escherichia coli O144 tRNA-Cys
  1597. Escherichia coli O145:H25 str. 07-3858 tRNA-Cys
  1598. Escherichia coli O145:H25 tRNA-Cys
  1599. Escherichia coli O145:H28 str. 2009C-3292 tRNA-Cys
  1600. Escherichia coli O145:H28 str. 4865/96 tRNA-Cys
  1601. Escherichia coli O145:H28 str. RM12581 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1602. Escherichia coli O145:H28 str. RM12761 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1603. Escherichia coli O145:H28 str. RM13514 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1604. Escherichia coli O145:H28 str. RM13516 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1605. Escherichia coli O145:H28 tRNA-Cys
  1606. Escherichia coli O145:H34 tRNA-Cys
  1607. Escherichia coli O145:NM str. 06-3484 tRNA-Cys
  1608. Escherichia coli O145:NM str. 08-4270 tRNA-Cys
  1609. Escherichia coli O145:NM str. 2010C-3507 tRNA-Cys
  1610. Escherichia coli O145:NM str. 2010C-3508 tRNA-Cys
  1611. Escherichia coli O145:NM str. 2010C-3509 tRNA-Cys
  1612. Escherichia coli O145:NM str. 2010C-3510 tRNA-Cys
  1613. Escherichia coli O145:NM str. 2010C-3511 tRNA-Cys
  1614. Escherichia coli O145:NM str. 2010C-3516 tRNA-Cys
  1615. Escherichia coli O145:NM str. 2010C-3517 tRNA-Cys
  1616. Escherichia coli O145:NM str. 2010C-3518 tRNA-Cys
  1617. Escherichia coli O145:NM str. 2010C-3521 tRNA-Cys
  1618. Escherichia coli O145:NM str. 2010C-3526 tRNA-Cys
  1619. Escherichia coli O145:NM str. 2010C-4557C2 tRNA-Cys
  1620. Escherichia coli O145:NM str. 2012C-4474 tRNA-Cys
  1621. Escherichia coli O145:NM tRNA-Cys
  1622. Escherichia coli O145 str. RM9872 tRNA-Cys
  1623. Escherichia coli O145 tRNA-Cys
  1624. Escherichia coli O146:H21 str. 2010C-3325 tRNA-Cys
  1625. Escherichia coli O146:H21 tRNA-Cys
  1626. Escherichia coli O146 tRNA-Cys
  1627. Escherichia coli O149:H2 tRNA-Cys
  1628. Escherichia coli O14 tRNA-Cys
  1629. Escherichia coli O150:H6 tRNA-Cys
  1630. Escherichia coli O150 tRNA-Cys
  1631. Escherichia coli O151:H8 tRNA-Cys
  1632. Escherichia coli O152:H23 tRNA-Cys
  1633. Escherichia coli O153:H12 tRNA-Cys
  1634. Escherichia coli O153:H2 str. 2010C-5034 tRNA-Cys
  1635. Escherichia coli O153 tRNA-Cys
  1636. Escherichia coli O155:H21 tRNA-Cys
  1637. Escherichia coli O155 tRNA-Cys
  1638. Escherichia coli O156:H25 str. 2011C-3602 tRNA-Cys
  1639. Escherichia coli O156:H28 tRNA-Cys
  1640. Escherichia coli O156:H5 tRNA-Cys
  1641. Escherichia coli O157:H16 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1642. Escherichia coli O157:H43 str. T22 tRNA-Cys
  1643. Escherichia coli O157:H43 tRNA-Cys
  1644. Escherichia coli O157:H7 str. 06-3745 tRNA-Cys
  1645. Escherichia coli O157:H7 str. 06-4039 tRNA-Cys
  1646. Escherichia coli O157:H7 str. 07-3091 tRNA-Cys
  1647. Escherichia coli O157:H7 str. 07-3391 tRNA-Cys
  1648. Escherichia coli O157:H7 str. 08-3037 tRNA-Cys
  1649. Escherichia coli O157:H7 str. 08-3527 tRNA-Cys
  1650. Escherichia coli O157:H7 str. 08-4169 tRNA-Cys
  1651. Escherichia coli O157:H7 str. 08-4529 tRNA-Cys
  1652. Escherichia coli O157:H7 str. 2009C-4258 tRNA-Cys
  1653. Escherichia coli O157:H7 str. 2009EL1449 tRNA-Cys
  1654. Escherichia coli O157:H7 str. 2009EL1705 tRNA-Cys
  1655. Escherichia coli O157:H7 str. 2009EL1913 tRNA-Cys
  1656. Escherichia coli O157:H7 str. 2009EL2109 tRNA-Cys
  1657. Escherichia coli O157:H7 str. 2010C-4979C1 tRNA-Cys
  1658. Escherichia coli O157:H7 str. 2011EL-1107 tRNA-Cys
  1659. Escherichia coli O157:H7 str. 2011EL-2090 tRNA-Cys
  1660. Escherichia coli O157:H7 str. 2011EL-2091 tRNA-Cys
  1661. Escherichia coli O157:H7 str. 2011EL-2092 tRNA-Cys
  1662. Escherichia coli O157:H7 str. 2011EL-2093 tRNA-Cys
  1663. Escherichia coli O157:H7 str. 2011EL-2094 tRNA-Cys
  1664. Escherichia coli O157:H7 str. 2011EL-2096 tRNA-Cys
  1665. Escherichia coli O157:H7 str. 2011EL-2097 tRNA-Cys
  1666. Escherichia coli O157:H7 str. 2011EL-2098 tRNA-Cys
  1667. Escherichia coli O157:H7 str. 2011EL-2099 tRNA-Cys
  1668. Escherichia coli O157:H7 str. 2011EL-2101 tRNA-Cys
  1669. Escherichia coli O157:H7 str. 2011EL-2103 tRNA-Cys
  1670. Escherichia coli O157:H7 str. 2011EL-2104 tRNA-Cys
  1671. Escherichia coli O157:H7 str. 2011EL-2105 tRNA-Cys
  1672. Escherichia coli O157:H7 str. 2011EL-2106 tRNA-Cys
  1673. Escherichia coli O157:H7 str. 2011EL-2107 tRNA-Cys
  1674. Escherichia coli O157:H7 str. 2011EL-2108 tRNA-Cys
  1675. Escherichia coli O157:H7 str. 2011EL-2109 tRNA-Cys
  1676. Escherichia coli O157:H7 str. 2011EL-2111 tRNA-Cys
  1677. Escherichia coli O157:H7 str. 2011EL-2112 tRNA-Cys
  1678. Escherichia coli O157:H7 str. 2011EL-2113 tRNA-Cys
  1679. Escherichia coli O157:H7 str. 2011EL-2114 tRNA-Cys
  1680. Escherichia coli O157:H7 str. 2011EL-2286 tRNA-Cys
  1681. Escherichia coli O157:H7 str. 2011EL-2287 tRNA-Cys
  1682. Escherichia coli O157:H7 str. 2011EL-2288 tRNA-Cys
  1683. Escherichia coli O157:H7 str. 2011EL-2289 tRNA-Cys
  1684. Escherichia coli O157:H7 str. 2011EL-2290 tRNA-Cys
  1685. Escherichia coli O157:H7 str. 2011EL-2312 tRNA-Cys
  1686. Escherichia coli O157:H7 str. 2011EL-2313 tRNA-Cys
  1687. Escherichia coli O157:H7 str. EC10 tRNA-Cys
  1688. Escherichia coli O157:H7 str. EC1825 tRNA-Cys
  1689. Escherichia coli O157:H7 str. EC4042 tRNA-Cys
  1690. Escherichia coli O157:H7 str. EC4045 tRNA-Cys
  1691. Escherichia coli O157:H7 str. EC4076 tRNA-Cys
  1692. Escherichia coli O157:H7 str. EC4113 tRNA-Cys
  1693. Escherichia coli O157:H7 str. EC4115 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1694. Escherichia coli O157:H7 str. EC4206 tRNA-Cys
  1695. Escherichia coli O157:H7 str. EC4401 tRNA-Cys
  1696. Escherichia coli O157:H7 str. EC4486 tRNA-Cys
  1697. Escherichia coli O157:H7 str. EC4501 tRNA-Cys
  1698. Escherichia coli O157:H7 str. EDL933 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1699. Escherichia coli O157:H7 str. F6142 tRNA-Cys
  1700. Escherichia coli O157:H7 str. F6749 tRNA-Cys
  1701. Escherichia coli O157:H7 str. F6750 tRNA-Cys
  1702. Escherichia coli O157:H7 str. F6751 tRNA-Cys
  1703. Escherichia coli O157:H7 str. F7350 tRNA-Cys
  1704. Escherichia coli O157:H7 str. F7377 tRNA-Cys
  1705. Escherichia coli O157:H7 str. F7384 tRNA-Cys
  1706. Escherichia coli O157:H7 str. F7410 tRNA-Cys
  1707. Escherichia coli O157:H7 str. F8092B tRNA-Cys
  1708. Escherichia coli O157:H7 str. G5101 tRNA-Cys
  1709. Escherichia coli O157:H7 str. G5303 tRNA-Cys
  1710. Escherichia coli O157:H7 str. H2495 tRNA-Cys
  1711. Escherichia coli O157:H7 str. H2498 tRNA-Cys
  1712. Escherichia coli O157:H7 str. K1420 tRNA-Cys
  1713. Escherichia coli O157:H7 str. K1793 tRNA-Cys
  1714. Escherichia coli O157:H7 str. K1795 tRNA-Cys
  1715. Escherichia coli O157:H7 str. K1796 tRNA-Cys
  1716. Escherichia coli O157:H7 str. K1845 tRNA-Cys
  1717. Escherichia coli O157:H7 str. K1921 tRNA-Cys
  1718. Escherichia coli O157:H7 str. K1927 tRNA-Cys
  1719. Escherichia coli O157:H7 str. K2188 tRNA-Cys
  1720. Escherichia coli O157:H7 str. K2191 tRNA-Cys
  1721. Escherichia coli O157:H7 str. K2192 tRNA-Cys
  1722. Escherichia coli O157:H7 str. K2324 tRNA-Cys
  1723. Escherichia coli O157:H7 str. K2581 tRNA-Cys
  1724. Escherichia coli O157:H7 str. K2622 tRNA-Cys
  1725. Escherichia coli O157:H7 str. K2845 tRNA-Cys
  1726. Escherichia coli O157:H7 str. K2854 tRNA-Cys
  1727. Escherichia coli O157:H7 str. K4396 tRNA-Cys
  1728. Escherichia coli O157:H7 str. K4405 tRNA-Cys
  1729. Escherichia coli O157:H7 str. K4406 tRNA-Cys
  1730. Escherichia coli O157:H7 str. K4527 tRNA-Cys
  1731. Escherichia coli O157:H7 str. K5418 tRNA-Cys
  1732. Escherichia coli O157:H7 str. K5448 tRNA-Cys
  1733. Escherichia coli O157:H7 str. K5449 tRNA-Cys
  1734. Escherichia coli O157:H7 str. K5453 tRNA-Cys
  1735. Escherichia coli O157:H7 str. K5460 tRNA-Cys
  1736. Escherichia coli O157:H7 str. K5467 tRNA-Cys
  1737. Escherichia coli O157:H7 str. K5602 tRNA-Cys
  1738. Escherichia coli O157:H7 str. K5607 tRNA-Cys
  1739. Escherichia coli O157:H7 str. K5609 tRNA-Cys
  1740. Escherichia coli O157:H7 str. K5806 tRNA-Cys
  1741. Escherichia coli O157:H7 str. K5852 tRNA-Cys
  1742. Escherichia coli O157:H7 str. K6590 tRNA-Cys
  1743. Escherichia coli O157:H7 str. K6676 tRNA-Cys
  1744. Escherichia coli O157:H7 str. K6687 tRNA-Cys
  1745. Escherichia coli O157:H7 str. K7140 tRNA-Cys
  1746. Escherichia coli O157:H7 str. LSU-61 tRNA-Cys
  1747. Escherichia coli O157:H7 str. Sakai tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1748. Escherichia coli O157:H7 str. SS17 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1749. Escherichia coli O157:H7 str. SS52 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1750. Escherichia coli O157:H7 str. TW14313 tRNA-Cys
  1751. Escherichia coli O157:H7 str. TW14359 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1752. Escherichia coli O157:H7 str. TW14588 tRNA-Cys
  1753. Escherichia coli O157:H7 tRNA-Cys
  1754. Escherichia coli O157:H- str. 493-89 tRNA-Cys
  1755. Escherichia coli O157:H- str. H 2687 tRNA-Cys
  1756. Escherichia coli O157:H- tRNA-Cys
  1757. Escherichia coli O157:NM str. 08-4540 tRNA-Cys
  1758. Escherichia coli O157:NM tRNA-Cys
  1759. Escherichia coli O157: str. 2010EL-2044 tRNA-Cys
  1760. Escherichia coli O157: str. 2010EL-2045 tRNA-Cys
  1761. Escherichia coli O157 tRNA-Cys
  1762. Escherichia coli O158:H23 tRNA-Cys
  1763. Escherichia coli O159:H10 tRNA-Cys
  1764. Escherichia coli O159:H19 tRNA-Cys
  1765. Escherichia coli O15:H12 tRNA-Cys
  1766. Escherichia coli O15:H16 tRNA-Cys
  1767. Escherichia coli O15:H18 str. K1516 tRNA-Cys
  1768. Escherichia coli O15:H18 tRNA-Cys
  1769. Escherichia coli O15:H21 tRNA-Cys
  1770. Escherichia coli O15 tRNA-Cys
  1771. Escherichia coli O160 tRNA-Cys
  1772. Escherichia coli O163 tRNA-Cys
  1773. Escherichia coli O165:H25 str. 2010C-4874 tRNA-Cys
  1774. Escherichia coli O166:H16 tRNA-Cys
  1775. Escherichia coli O166:H49 tRNA-Cys
  1776. Escherichia coli O166:H6 tRNA-Cys
  1777. Escherichia coli O167:H26 tRNA-Cys
  1778. Escherichia coli O167:H9 tRNA-Cys
  1779. Escherichia coli O168:H8 tRNA-Cys
  1780. Escherichia coli O168 tRNA-Cys
  1781. Escherichia coli O169:H41 str. F9792 tRNA-Cys
  1782. Escherichia coli O16:H16 tRNA-Cys
  1783. Escherichia coli O16:H48 tRNA-Cys
  1784. Escherichia coli O16 tRNA-Cys
  1785. Escherichia coli O170:H18 tRNA-Cys
  1786. Escherichia coli O170:H5 tRNA-Cys
  1787. Escherichia coli O170 tRNA-Cys
  1788. Escherichia coli O171 tRNA-Cys
  1789. Escherichia coli O174:H21 str. 03-3269 tRNA-Cys
  1790. Escherichia coli O174:H21 tRNA-Cys
  1791. Escherichia coli O174:H7 tRNA-Cys
  1792. Escherichia coli O174:H8 str. 04-3038 tRNA-Cys
  1793. Escherichia coli O174:H8 tRNA-Cys
  1794. Escherichia coli O174 tRNA-Cys
  1795. Escherichia coli O175:H26 tRNA-Cys
  1796. Escherichia coli O176:H45 tRNA-Cys
  1797. Escherichia coli O177:NM str. 2010C-4558 tRNA-Cys
  1798. Escherichia coli O177 tRNA-Cys
  1799. Escherichia coli O178:H7 tRNA-Cys
  1800. Escherichia coli O178 tRNA-Cys
  1801. Escherichia coli O17or77:H18 tRNA-Cys
  1802. Escherichia coli O180:H14 tRNA-Cys
  1803. Escherichia coli O182:H16 tRNA-Cys
  1804. Escherichia coli O183:H18 tRNA-Cys
  1805. Escherichia coli O187:H52 tRNA-Cys
  1806. Escherichia coli O18ac:H14 tRNA-Cys
  1807. Escherichia coli O18:H14 tRNA-Cys
  1808. Escherichia coli O18:H1 tRNA-Cys
  1809. Escherichia coli O18:H7 tRNA-Cys
  1810. Escherichia coli O18 str. F10018-41 tRNA-Cys
  1811. Escherichia coli O19:H42 tRNA-Cys
  1812. Escherichia coli O19:H7 tRNA-Cys
  1813. Escherichia coli O19 tRNA-Cys
  1814. Escherichia coli O1:H42 tRNA-Cys
  1815. Escherichia coli O1:H7 tRNA-Cys
  1816. Escherichia coli O1:HNT tRNA-Cys
  1817. Escherichia coli O1 tRNA-Cys
  1818. Escherichia coli O20:H12 tRNA-Cys
  1819. Escherichia coli O21:H21 tRNA-Cys
  1820. Escherichia coli O21:H28 tRNA-Cys
  1821. Escherichia coli O21 tRNA-Cys
  1822. Escherichia coli O22:H16 tRNA-Cys
  1823. Escherichia coli O22:H8 tRNA-Cys
  1824. Escherichia coli O22 tRNA-Cys
  1825. Escherichia coli O24:H4 tRNA-Cys
  1826. Escherichia coli O24 tRNA-Cys
  1827. Escherichia coli O25b:H4-ST131 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1828. Escherichia coli O25b:H4 tRNA-Cys
  1829. Escherichia coli O25:H10 tRNA-Cys
  1830. Escherichia coli O25:H4 tRNA-Cys
  1831. Escherichia coli O25:NM str. E2539C1 tRNA-Cys
  1832. Escherichia coli O25 tRNA-Cys
  1833. Escherichia coli O26:H11 str. 03-3500 tRNA-Cys
  1834. Escherichia coli O26:H11 str. 05-3646 tRNA-Cys
  1835. Escherichia coli O26:H11 str. 06-3464 tRNA-Cys
  1836. Escherichia coli O26:H11 str. 11368 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1837. Escherichia coli O26:H11 str. 2009C-3612 tRNA-Cys
  1838. Escherichia coli O26:H11 str. 2009C-3689 tRNA-Cys
  1839. Escherichia coli O26:H11 str. 2009C-3996 tRNA-Cys
  1840. Escherichia coli O26:H11 str. 2009C-4760 tRNA-Cys
  1841. Escherichia coli O26:H11 str. 2009C-4826 tRNA-Cys
  1842. Escherichia coli O26:H11 str. 2010C-3051 tRNA-Cys
  1843. Escherichia coli O26:H11 str. 2010C-3472 tRNA-Cys
  1844. Escherichia coli O26:H11 str. 2010C-3871 tRNA-Cys
  1845. Escherichia coli O26:H11 str. 2010C-3902 tRNA-Cys
  1846. Escherichia coli O26:H11 str. 2010C-4244 tRNA-Cys
  1847. Escherichia coli O26:H11 str. 2010C-4430 tRNA-Cys
  1848. Escherichia coli O26:H11 str. 2010C-4819 tRNA-Cys
  1849. Escherichia coli O26:H11 str. 2010C-4834 tRNA-Cys
  1850. Escherichia coli O26:H11 str. 2010C-5028 tRNA-Cys
  1851. Escherichia coli O26:H11 str. 2010EL-1699 tRNA-Cys
  1852. Escherichia coli O26:H11 str. 2011C-3270 tRNA-Cys
  1853. Escherichia coli O26:H11 str. 2011C-3274 tRNA-Cys
  1854. Escherichia coli O26:H11 str. 2011C-3282 tRNA-Cys
  1855. Escherichia coli O26:H11 str. 2011C-3387 tRNA-Cys
  1856. Escherichia coli O26:H11 str. 2011C-3506 tRNA-Cys
  1857. Escherichia coli O26:H11 str. 2011C-3655 tRNA-Cys
  1858. Escherichia coli O26:H11 str. CFSAN001629 tRNA-Cys
  1859. Escherichia coli O26:H11 str. CVM10021 tRNA-Cys
  1860. Escherichia coli O26:H11 str. CVM10026 tRNA-Cys
  1861. Escherichia coli O26:H11 str. CVM10030 tRNA-Cys
  1862. Escherichia coli O26:H11 str. CVM10224 tRNA-Cys
  1863. Escherichia coli O26:H11 str. CVM9942 tRNA-Cys
  1864. Escherichia coli O26:H11 str. CVM9952 tRNA-Cys
  1865. Escherichia coli O26:H11 tRNA-Cys
  1866. Escherichia coli O26:H1 str. 2009C-4747 tRNA-Cys
  1867. Escherichia coli O26:NM str. 2010C-4347 tRNA-Cys
  1868. Escherichia coli O26:NM str. 2010C-4788 tRNA-Cys
  1869. Escherichia coli O26 str. RM10386 tRNA-Cys
  1870. Escherichia coli O26 str. RM8426 tRNA-Cys
  1871. Escherichia coli O26 tRNA-Cys
  1872. Escherichia coli O28/42:H37 tRNA-Cys
  1873. Escherichia coli O28ac:NM str. 02-3404 tRNA-Cys
  1874. Escherichia coli O2:H14 tRNA-Cys
  1875. Escherichia coli O2:H1 tRNA-Cys
  1876. Escherichia coli O2:H32 tRNA-Cys
  1877. Escherichia coli O2:H6 tRNA-Cys
  1878. Escherichia coli O2:K2:H1 tRNA-Cys
  1879. Escherichia coli O2 tRNA-Cys
  1880. Escherichia coli O32:H37 str. P4 tRNA-Cys
  1881. Escherichia coli O32 tRNA-Cys
  1882. Escherichia coli O33 tRNA-Cys
  1883. Escherichia coli O35 tRNA-Cys
  1884. Escherichia coli O36:H5 tRNA-Cys
  1885. Escherichia coli O36 tRNA-Cys
  1886. Escherichia coli O38:H26 tRNA-Cys
  1887. Escherichia coli O39:H21 tRNA-Cys
  1888. Escherichia coli O39:H4 tRNA-Cys
  1889. Escherichia coli O3 tRNA-Cys
  1890. Escherichia coli O40:H32 tRNA-Cys
  1891. Escherichia coli O43:H14 tRNA-Cys
  1892. Escherichia coli O43:H2 tRNA-Cys
  1893. Escherichia coli O43 str. RM10042 tRNA-Cys
  1894. Escherichia coli O43 tRNA-Cys
  1895. Escherichia coli O45:H16 tRNA-Cys
  1896. Escherichia coli O45:H2 str. 01-3147 tRNA-Cys
  1897. Escherichia coli O45:H2 str. 2009C-3686 tRNA-Cys
  1898. Escherichia coli O45:H2 str. 2009C-4780 tRNA-Cys
  1899. Escherichia coli O45:H2 str. 2010C-3876 tRNA-Cys
  1900. Escherichia coli O45:H2 str. 2010C-4211 tRNA-Cys
  1901. Escherichia coli O45:H2 tRNA-Cys
  1902. Escherichia coli O45 tRNA-Cys
  1903. Escherichia coli O49:H9 tRNA-Cys
  1904. Escherichia coli O4:H2 tRNA-Cys
  1905. Escherichia coli O4:H5 tRNA-Cys
  1906. Escherichia coli O51:H51 tRNA-Cys
  1907. Escherichia coli O53 tRNA-Cys
  1908. Escherichia coli O54 tRNA-Cys
  1909. Escherichia coli O55:H7 str. 06-3555 tRNA-Cys
  1910. Escherichia coli O55:H7 str. 3256-97 tRNA-Cys
  1911. Escherichia coli O55:H7 str. CB9615 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1912. Escherichia coli O55:H7 str. RM12579 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1913. Escherichia coli O55:H7 str. TB182A tRNA-Cys
  1914. Escherichia coli O55:H7 str. USDA 5905 tRNA-Cys
  1915. Escherichia coli O55:H7 tRNA-Cys
  1916. Escherichia coli O55 tRNA-Cys
  1917. Escherichia coli O5:K4(L):H4 str. ATCC 23502 tRNA-Cys-GCA
  1918. Escherichia coli O5 tRNA-Cys
  1919. Escherichia coli O66:H5 tRNA-Cys
  1920. Escherichia coli O68:H12 tRNA-Cys
  1921. Escherichia coli O69:H11 str. 06-3325 tRNA-Cys
  1922. Escherichia coli O69:H11 str. 07-3763 tRNA-Cys
  1923. Escherichia coli O69:H11 str. 07-4281 tRNA-Cys
  1924. Escherichia coli O69:H11 str. 08-4661 tRNA-Cys
  1925. Escherichia coli O69:H11 str. 2009C-3601 tRNA-Cys
  1926. Escherichia coli O6:H10 tRNA-Cys
  1927. Escherichia coli O6:H16:CFA/II str. B2C tRNA-Cys
  1928. Escherichia coli O6:H16 str. 99-3165 tRNA-Cys
  1929. Escherichia coli O6:H16 str. F5656C1 tRNA-Cys
  1930. Escherichia coli O6:H1 tRNA-Cys
  1931. Escherichia coli O6:H31 tRNA-Cys
  1932. Escherichia coli O6:H34 tRNA-Cys
  1933. Escherichia coli O6:H49 tRNA-Cys
  1934. Escherichia coli O6:K2:H1 tRNA-Cys
  1935. Escherichia coli O6 tRNA-Cys
  1936. Escherichia coli O70:H25 tRNA-Cys
  1937. Escherichia coli O71:H6 tRNA-Cys
  1938. Escherichia coli O73 tRNA-Cys
  1939. Escherichia coli O74:H28 tRNA-Cys
  1940. Escherichia coli O74:H39 tRNA-Cys
  1941. Escherichia coli O74:H8 tRNA-Cys
  1942. Escherichia coli O74 tRNA-Cys
  1943. Escherichia coli O76 tRNA-Cys
  1944. Escherichia coli O78:H12 str. 00-3279 tRNA-Cys
  1945. Escherichia coli O78:H42 tRNA-Cys
  1946. Escherichia coli O78:H4 tRNA-Cys
  1947. Escherichia coli O78 tRNA-Cys
  1948. Escherichia coli O79:H4 tRNA-Cys
  1949. Escherichia coli O79:H7 str. 06-3501 tRNA-Cys
  1950. Escherichia coli O79 tRNA-Cys
  1951. unidentified tRNA-Cys
  1952. Escherichia coli O7:H4 tRNA-Cys
  1953. Escherichia coli O7:H6 tRNA-Cys
  1954. Escherichia coli O7:H7 tRNA-Cys
  1955. Escherichia coli O7:K1 str. CE10 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1956. Escherichia coli O80:H26 tRNA-Cys
  1957. Escherichia coli O80:H45 tRNA-Cys
  1958. Escherichia coli O81:H27 tRNA-Cys
  1959. Escherichia coli O81:NM str. 02-3012 tRNA-Cys
  1960. Escherichia coli O82 tRNA-Cys
  1961. Escherichia coli O83:H1 str. NRG 857C tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  1962. Escherichia coli O83:H1 tRNA-Cys
  1963. Escherichia coli O83:H31 tRNA-Cys
  1964. Escherichia coli O83:H32 tRNA-Cys
  1965. Escherichia coli O83:H7 tRNA-Cys
  1966. Escherichia coli O83 tRNA-Cys
  1967. Escherichia coli O83w tRNA-Cys
  1968. Escherichia coli O84:H7 tRNA-Cys
  1969. Escherichia coli O85:H1 tRNA-Cys
  1970. Escherichia coli O86:H34 str. 99-3124 tRNA-Cys
  1971. Escherichia coli O86:H8 tRNA-Cys
  1972. Escherichia coli O87:H39 tRNA-Cys
  1973. Escherichia coli O88:H1 tRNA-Cys
  1974. Escherichia coli O88:H25 tRNA-Cys
  1975. Escherichia coli O88:H4 tRNA-Cys
  1976. Escherichia coli O88:H8 tRNA-Cys
  1977. Escherichia coli O89m:H10 tRNA-Cys
  1978. Escherichia coli O89m:H9 tRNA-Cys
  1979. Escherichia coli O8:H10 tRNA-Cys
  1980. Escherichia coli O8:H19 tRNA-Cys
  1981. Escherichia coli O8:H20 tRNA-Cys
  1982. Escherichia coli O8:H28 tRNA-Cys
  1983. Escherichia coli O8:H31 tRNA-Cys
  1984. Escherichia coli O8:H36 tRNA-Cys
  1985. Escherichia coli O8:H49 tRNA-Cys
  1986. Escherichia coli O8:H7 tRNA-Cys
  1987. Escherichia coli O8:H8 tRNA-Cys
  1988. Escherichia coli O8:H9 tRNA-Cys
  1989. Escherichia coli O8 tRNA-Cys
  1990. Escherichia coli O91:H14 str. 06-3691 tRNA-Cys
  1991. Escherichia coli O91:H14 str. 2009C-3227 tRNA-Cys
  1992. Escherichia coli O91:H21 str. 2009C-3740 tRNA-Cys
  1993. Escherichia coli O91:H21 str. 2009C-4646 tRNA-Cys
  1994. Escherichia coli O91:H21 tRNA-Cys
  1995. Escherichia coli O91:H28 tRNA-Cys
  1996. Escherichia coli O91:NM str. 2009C-3745 tRNA-Cys
  1997. Escherichia coli O91 str. RM7190 tRNA-Cys
  1998. Escherichia coli O91 tRNA-Cys
  1999. Escherichia coli O93:H19 tRNA-Cys
  2000. Escherichia coli O93:H21 tRNA-Cys
  2001. Escherichia coli O96 tRNA-Cys
  2002. Escherichia coli O99:H27 tRNA-Cys
  2003. Escherichia coli O9:H10 tRNA-Cys
  2004. Escherichia coli OK1180 tRNA-Cys
  2005. Escherichia coli OK1357 tRNA-Cys
  2006. Escherichia coli ONT:H33 str. C48/93 tRNA-Cys
  2007. Escherichia coli OP50 tRNA-Cys
  2008. Escherichia coli Ou:H8 tRNA-Cys
  2009. Escherichia coli OX01:H8 tRNA-Cys
  2010. Escherichia coli OX21:H7 tRNA-Cys
  2011. Escherichia coli OX25:H28 tRNA-Cys
  2012. Escherichia coli OX25:H6 tRNA-Cys
  2013. Escherichia coli OX38:H47 tRNA-Cys
  2014. Escherichia coli P0298942.10 tRNA-Cys
  2015. Escherichia coli P0298942.11 tRNA-Cys
  2016. Escherichia coli P0298942.12 tRNA-Cys
  2017. Escherichia coli P0298942.14 tRNA-Cys
  2018. Escherichia coli P0298942.15 tRNA-Cys
  2019. Escherichia coli P0298942.1 tRNA-Cys
  2020. Escherichia coli P0298942.2 tRNA-Cys
  2021. Escherichia coli P0298942.3 tRNA-Cys
  2022. Escherichia coli P0298942.4 tRNA-Cys
  2023. Escherichia coli P0298942.6 tRNA-Cys
  2024. Escherichia coli P0298942.7 tRNA-Cys
  2025. Escherichia coli P0298942.8 tRNA-Cys
  2026. Escherichia coli P0298942.9 tRNA-Cys
  2027. Escherichia coli P0299438.10 tRNA-Cys
  2028. Escherichia coli P0299438.11 tRNA-Cys
  2029. Escherichia coli P0299438.2 tRNA-Cys
  2030. Escherichia coli P0299438.3 tRNA-Cys
  2031. Escherichia coli P0299438.4 tRNA-Cys
  2032. Escherichia coli P0299438.5 tRNA-Cys
  2033. Escherichia coli P0299438.6 tRNA-Cys
  2034. Escherichia coli P0299438.7 tRNA-Cys
  2035. Escherichia coli P0299438.8 tRNA-Cys
  2036. Escherichia coli P0299438.9 tRNA-Cys
  2037. Escherichia coli P0299483.1 tRNA-Cys
  2038. Escherichia coli P0299483.2 tRNA-Cys
  2039. Escherichia coli P0299483.3 tRNA-Cys
  2040. Escherichia coli P0299917.10 tRNA-Cys
  2041. Escherichia coli P0299917.1 tRNA-Cys
  2042. Escherichia coli P0299917.2 tRNA-Cys
  2043. Escherichia coli P0299917.3 tRNA-Cys
  2044. Escherichia coli P0299917.4 tRNA-Cys
  2045. Escherichia coli P0299917.5 tRNA-Cys
  2046. Escherichia coli P0299917.6 tRNA-Cys
  2047. Escherichia coli P0299917.7 tRNA-Cys
  2048. Escherichia coli P0299917.8 tRNA-Cys
  2049. Escherichia coli P0299917.9 tRNA-Cys
  2050. Escherichia coli P0301867.11 tRNA-Cys
  2051. Escherichia coli P0301867.13 tRNA-Cys
  2052. Escherichia coli P0301867.1 tRNA-Cys
  2053. Escherichia coli P0301867.2 tRNA-Cys
  2054. Escherichia coli P0301867.3 tRNA-Cys
  2055. Escherichia coli P0301867.4 tRNA-Cys
  2056. Escherichia coli P0301867.5 tRNA-Cys
  2057. Escherichia coli P0301867.7 tRNA-Cys
  2058. Escherichia coli P0301867.8 tRNA-Cys
  2059. Escherichia coli P0301904.3 tRNA-Cys
  2060. Escherichia coli P0302293.10 tRNA-Cys
  2061. Escherichia coli P0302293.2 tRNA-Cys
  2062. Escherichia coli P0302293.3 tRNA-Cys
  2063. Escherichia coli P0302293.4 tRNA-Cys
  2064. Escherichia coli P0302293.6 tRNA-Cys
  2065. Escherichia coli P0302293.7 tRNA-Cys
  2066. Escherichia coli P0302293.8 tRNA-Cys
  2067. Escherichia coli P0302293.9 tRNA-Cys
  2068. Escherichia coli P0302308.10 tRNA-Cys
  2069. Escherichia coli P0302308.11 tRNA-Cys
  2070. Escherichia coli P0302308.12 tRNA-Cys
  2071. Escherichia coli P0302308.13 tRNA-Cys
  2072. Escherichia coli P0302308.14 tRNA-Cys
  2073. Escherichia coli P0302308.1 tRNA-Cys
  2074. Escherichia coli P0302308.2 tRNA-Cys
  2075. Escherichia coli P0302308.3 tRNA-Cys
  2076. Escherichia coli P0302308.4 tRNA-Cys
  2077. Escherichia coli P0302308.5 tRNA-Cys
  2078. Escherichia coli P0304777.10 tRNA-Cys
  2079. Escherichia coli P0304777.11 tRNA-Cys
  2080. Escherichia coli P0304777.12 tRNA-Cys
  2081. Escherichia coli P0304777.13 tRNA-Cys
  2082. Escherichia coli P0304777.14 tRNA-Cys
  2083. Escherichia coli P0304777.15 tRNA-Cys
  2084. Escherichia coli P0304777.1 tRNA-Cys
  2085. Escherichia coli P0304777.2 tRNA-Cys
  2086. Escherichia coli P0304777.3 tRNA-Cys
  2087. Escherichia coli P0304777.4 tRNA-Cys
  2088. Escherichia coli P0304777.5 tRNA-Cys
  2089. Escherichia coli P0304777.7 tRNA-Cys
  2090. Escherichia coli P0304777.8 tRNA-Cys
  2091. Escherichia coli P0304777.9 tRNA-Cys
  2092. Escherichia coli P0304799.3 tRNA-Cys
  2093. Escherichia coli P0304816.10 tRNA-Cys
  2094. Escherichia coli P0304816.11 tRNA-Cys
  2095. Escherichia coli P0304816.12 tRNA-Cys
  2096. Escherichia coli P0304816.13 tRNA-Cys
  2097. Escherichia coli P0304816.14 tRNA-Cys
  2098. Escherichia coli P0304816.15 tRNA-Cys
  2099. Escherichia coli P0304816.1 tRNA-Cys
  2100. Escherichia coli P0304816.2 tRNA-Cys
  2101. Escherichia coli P0304816.3 tRNA-Cys
  2102. Escherichia coli P0304816.4 tRNA-Cys
  2103. Escherichia coli P0304816.5 tRNA-Cys
  2104. Escherichia coli P0304816.6 tRNA-Cys
  2105. Escherichia coli P0304816.7 tRNA-Cys
  2106. Escherichia coli P0304816.8 tRNA-Cys
  2107. Escherichia coli P0304816.9 tRNA-Cys
  2108. Escherichia coli P0305260.10 tRNA-Cys
  2109. Escherichia coli P0305260.11 tRNA-Cys
  2110. Escherichia coli P0305260.12 tRNA-Cys
  2111. Escherichia coli P0305260.13 tRNA-Cys
  2112. Escherichia coli P0305260.15 tRNA-Cys
  2113. Escherichia coli P0305260.1 tRNA-Cys
  2114. Escherichia coli P0305260.2 tRNA-Cys
  2115. Escherichia coli P0305260.3 tRNA-Cys
  2116. Escherichia coli P0305260.4 tRNA-Cys
  2117. Escherichia coli P0305260.5 tRNA-Cys
  2118. Escherichia coli P0305260.6 tRNA-Cys
  2119. Escherichia coli P0305260.7 tRNA-Cys
  2120. Escherichia coli P0305260.8 tRNA-Cys
  2121. Escherichia coli P0305260.9 tRNA-Cys
  2122. Escherichia coli p0305293.10 tRNA-Cys
  2123. Escherichia coli p0305293.11 tRNA-Cys
  2124. Escherichia coli p0305293.12 tRNA-Cys
  2125. Escherichia coli p0305293.13 tRNA-Cys
  2126. Escherichia coli p0305293.15 tRNA-Cys
  2127. Escherichia coli p0305293.1 tRNA-Cys
  2128. Escherichia coli p0305293.2 tRNA-Cys
  2129. Escherichia coli p0305293.3 tRNA-Cys
  2130. Escherichia coli p0305293.4 tRNA-Cys
  2131. Escherichia coli p0305293.5 tRNA-Cys
  2132. Escherichia coli p0305293.6 tRNA-Cys
  2133. Escherichia coli p0305293.7 tRNA-Cys
  2134. Escherichia coli p0305293.8 tRNA-Cys
  2135. Escherichia coli p0305293.9 tRNA-Cys
  2136. Escherichia coli P12b tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2137. Escherichia coli P4-96 tRNA-Cys
  2138. Escherichia coli P4-NR tRNA-Cys
  2139. Escherichia coli PA10 tRNA-Cys
  2140. Escherichia coli PA11 tRNA-Cys
  2141. Escherichia coli PA13 tRNA-Cys
  2142. Escherichia coli PA14 tRNA-Cys
  2143. Escherichia coli PA15 tRNA-Cys
  2144. Escherichia coli PA22 tRNA-Cys
  2145. Escherichia coli PA23 tRNA-Cys
  2146. Escherichia coli PA24 tRNA-Cys
  2147. Escherichia coli PA25 tRNA-Cys
  2148. Escherichia coli PA28 tRNA-Cys
  2149. Escherichia coli PA2 tRNA-Cys
  2150. Escherichia coli PA31 tRNA-Cys
  2151. Escherichia coli PA32 tRNA-Cys
  2152. Escherichia coli PA33 tRNA-Cys
  2153. Escherichia coli PA34 tRNA-Cys
  2154. Escherichia coli PA35 tRNA-Cys
  2155. Escherichia coli PA38 tRNA-Cys
  2156. Escherichia coli PA39 tRNA-Cys
  2157. Escherichia coli PA3 tRNA-Cys
  2158. Escherichia coli PA40 tRNA-Cys
  2159. Escherichia coli PA41 tRNA-Cys
  2160. Escherichia coli PA42 tRNA-Cys
  2161. Escherichia coli PA45 tRNA-Cys
  2162. Escherichia coli PA47 tRNA-Cys
  2163. Escherichia coli PA48 tRNA-Cys
  2164. Escherichia coli PA49 tRNA-Cys
  2165. Escherichia coli PA4 tRNA-Cys
  2166. Escherichia coli PA5 tRNA-Cys
  2167. Escherichia coli PA7 tRNA-Cys
  2168. Escherichia coli PA8 tRNA-Cys
  2169. Escherichia coli PA9 tRNA-Cys
  2170. Escherichia coli PCN061 tRNA-Cys
  2171. Escherichia coli PMV-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2172. Escherichia coli R424 tRNA-Cys
  2173. Escherichia coli R527 tRNA-Cys
  2174. Escherichia coli RN587/1 tRNA-Cys
  2175. Escherichia coli RS218 tRNA-Cys
  2176. Escherichia coli S17 tRNA-Cys
  2177. Escherichia coli S88 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2178. Escherichia coli SaT040 tRNA-Cys
  2179. Escherichia coli SaT049 tRNA-Cys
  2180. Escherichia coli SaT158 tRNA-Cys
  2181. Escherichia coli SCI-07 tRNA-Cys
  2182. Escherichia coli SE11 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2183. Escherichia coli SE15 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2184. Escherichia coli SEPT362 tRNA-Cys
  2185. Escherichia coli SHECO001 tRNA-Cys
  2186. Escherichia coli SHECO002 tRNA-Cys
  2187. Escherichia coli SHECO003 tRNA-Cys
  2188. Escherichia coli SMS-3-5 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2189. Escherichia coli STEC_7v tRNA-Cys
  2190. Escherichia coli STEC_94C tRNA-Cys
  2191. Escherichia coli O91:H21 str. B2F1 tRNA-Cys
  2192. Escherichia coli STEC_C165-02 tRNA-Cys
  2193. Escherichia coli STEC_DG131-3 tRNA-Cys
  2194. Escherichia coli STEC_EH250 tRNA-Cys
  2195. Escherichia coli STEC_MHI813 tRNA-Cys
  2196. Escherichia coli STEC_O31 tRNA-Cys
  2197. Escherichia coli STEC_S1191 tRNA-Cys
  2198. Escherichia coli str. 'clone D i14' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2199. Escherichia coli str. 'clone D i2' tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2200. Escherichia coli str. K-12 substr. DH10B tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2201. Escherichia coli str. K-12 substr. MC4100 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2202. Escherichia coli str. K-12 substr. MDS42 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2203. Escherichia coli str. K-12 substr. MG1655 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2204. Escherichia coli str. K-12 substr. W3110 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2205. Escherichia coli str. Sanji tRNA-Cys
  2206. Escherichia coli SWW33 tRNA-Cys
  2207. Escherichia coli T1282_01 tRNA-Cys
  2208. Escherichia coli T1840_97 tRNA-Cys
  2209. Escherichia coli T234_00 tRNA-Cys
  2210. Escherichia coli T426 tRNA-Cys
  2211. Escherichia coli T924_01 tRNA-Cys
  2212. Escherichia coli TA007 tRNA-Cys
  2213. Escherichia coli TA008 tRNA-Cys
  2214. Escherichia coli TA014 tRNA-Cys
  2215. Escherichia coli TA054 tRNA-Cys
  2216. Escherichia coli TA124 tRNA-Cys
  2217. Escherichia coli TA143 tRNA-Cys
  2218. Escherichia coli TA144 tRNA-Cys
  2219. Escherichia coli TA206 tRNA-Cys
  2220. Escherichia coli TA249 tRNA-Cys
  2221. Escherichia coli TA255 tRNA-Cys
  2222. Escherichia coli TA271 tRNA-Cys
  2223. Escherichia coli TA280 tRNA-Cys
  2224. Escherichia coli TA447 tRNA-Cys
  2225. Escherichia coli TA464 tRNA-Cys
  2226. Escherichia coli ThroopD tRNA-Cys
  2227. Escherichia coli tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2228. Escherichia coli TT12B tRNA-Cys
  2229. Escherichia coli TW00353 tRNA-Cys
  2230. Escherichia coli TW06591 tRNA-Cys
  2231. Escherichia coli TW07509 tRNA-Cys
  2232. Escherichia coli TW07793 tRNA-Cys
  2233. Escherichia coli TW07945 tRNA-Cys
  2234. Escherichia coli TW09098 tRNA-Cys
  2235. Escherichia coli TW09109 tRNA-Cys
  2236. Escherichia coli TW09195 tRNA-Cys
  2237. Escherichia coli TW10119 tRNA-Cys
  2238. Escherichia coli TW10246 tRNA-Cys
  2239. Escherichia coli TW10509 tRNA-Cys
  2240. Escherichia coli TW11039 tRNA-Cys
  2241. Escherichia coli TW14301 tRNA-Cys
  2242. Escherichia coli TW14425 tRNA-Cys
  2243. Escherichia coli TW15901 tRNA-Cys
  2244. Escherichia coli Tx1686 tRNA-Cys
  2245. Escherichia coli TX1999 tRNA-Cys
  2246. Escherichia coli Tx3800 tRNA-Cys
  2247. Escherichia coli U004 tRNA-Cys
  2248. Escherichia coli U054 tRNA-Cys
  2249. Escherichia coli UCI 51 tRNA-Cys
  2250. Escherichia coli UCI 52 tRNA-Cys
  2251. Escherichia coli UCI 53 tRNA-Cys
  2252. Escherichia coli UCI 57 tRNA-Cys
  2253. Escherichia coli UCI 58 tRNA-Cys
  2254. Escherichia coli UCI 65 tRNA-Cys
  2255. Escherichia coli UCI 66 tRNA-Cys
  2256. Escherichia coli UM146 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2257. Escherichia coli UMEA 3014-1 tRNA-Cys
  2258. Escherichia coli UMEA 3022-1 tRNA-Cys
  2259. Escherichia coli UMEA 3033-1 tRNA-Cys
  2260. Escherichia coli UMEA 3041-1 tRNA-Cys
  2261. Escherichia coli UMEA 3052-1 tRNA-Cys
  2262. Escherichia coli UMEA 3053-1 tRNA-Cys
  2263. Escherichia coli UMEA 3065-1 tRNA-Cys
  2264. Escherichia coli UMEA 3087-1 tRNA-Cys
  2265. Escherichia coli UMEA 3088-1 tRNA-Cys
  2266. Escherichia coli UMEA 3097-1 tRNA-Cys
  2267. Escherichia coli UMEA 3108-1 tRNA-Cys
  2268. Escherichia coli UMEA 3113-1 tRNA-Cys
  2269. Escherichia coli UMEA 3117-1 tRNA-Cys
  2270. Escherichia coli UMEA 3121-1 tRNA-Cys
  2271. Escherichia coli UMEA 3122-1 tRNA-Cys
  2272. Escherichia coli UMEA 3124-1 tRNA-Cys
  2273. Escherichia coli UMEA 3139-1 tRNA-Cys
  2274. Escherichia coli UMEA 3140-1 tRNA-Cys
  2275. Escherichia coli UMEA 3144-1 tRNA-Cys
  2276. Escherichia coli UMEA 3148-1 tRNA-Cys
  2277. Escherichia coli UMEA 3150-1 tRNA-Cys
  2278. Escherichia coli UMEA 3151-1 tRNA-Cys
  2279. Escherichia coli UMEA 3152-1 tRNA-Cys
  2280. Escherichia coli UMEA 3155-1 tRNA-Cys
  2281. Escherichia coli UMEA 3159-1 tRNA-Cys
  2282. Escherichia coli UMEA 3160-1 tRNA-Cys
  2283. Escherichia coli UMEA 3161-1 tRNA-Cys
  2284. Escherichia coli UMEA 3162-1 tRNA-Cys
  2285. Escherichia coli UMEA 3163-1 tRNA-Cys
  2286. Escherichia coli UMEA 3172-1 tRNA-Cys
  2287. Escherichia coli UMEA 3173-1 tRNA-Cys
  2288. Escherichia coli UMEA 3174-1 tRNA-Cys
  2289. Escherichia coli UMEA 3175-1 tRNA-Cys
  2290. Escherichia coli UMEA 3176-1 tRNA-Cys
  2291. Escherichia coli UMEA 3178-1 tRNA-Cys
  2292. Escherichia coli UMEA 3180-1 tRNA-Cys
  2293. Escherichia coli UMEA 3185-1 tRNA-Cys
  2294. Escherichia coli UMEA 3190-1 tRNA-Cys
  2295. Escherichia coli UMEA 3193-1 tRNA-Cys
  2296. Escherichia coli UMEA 3199-1 tRNA-Cys
  2297. Escherichia coli UMEA 3200-1 tRNA-Cys
  2298. Escherichia coli UMEA 3201-1 tRNA-Cys
  2299. Escherichia coli UMEA 3203-1 tRNA-Cys
  2300. Escherichia coli UMEA 3206-1 tRNA-Cys
  2301. Escherichia coli UMEA 3208-1 tRNA-Cys
  2302. Escherichia coli UMEA 3212-1 tRNA-Cys
  2303. Escherichia coli UMEA 3215-1 tRNA-Cys
  2304. Escherichia coli UMEA 3216-1 tRNA-Cys
  2305. Escherichia coli UMEA 3217-1 tRNA-Cys
  2306. Escherichia coli UMEA 3220-1 tRNA-Cys
  2307. Escherichia coli UMEA 3221-1 tRNA-Cys
  2308. Escherichia coli UMEA 3222-1 tRNA-Cys
  2309. Escherichia coli UMEA 3230-1 tRNA-Cys
  2310. Escherichia coli UMEA 3233-1 tRNA-Cys
  2311. Escherichia coli UMEA 3240-1 tRNA-Cys
  2312. Escherichia coli UMEA 3244-1 tRNA-Cys
  2313. Escherichia coli UMEA 3252-1 tRNA-Cys
  2314. Escherichia coli UMEA 3257-1 tRNA-Cys
  2315. Escherichia coli UMEA 3264-1 tRNA-Cys
  2316. Escherichia coli UMEA 3268-1 tRNA-Cys
  2317. Escherichia coli UMEA 3271-1 tRNA-Cys
  2318. Escherichia coli UMEA 3290-1 tRNA-Cys
  2319. Escherichia coli UMEA 3292-1 tRNA-Cys
  2320. Escherichia coli UMEA 3298-1 tRNA-Cys
  2321. Escherichia coli UMEA 3304-1 tRNA-Cys
  2322. Escherichia coli UMEA 3314-1 tRNA-Cys
  2323. Escherichia coli UMEA 3317-1 tRNA-Cys
  2324. Escherichia coli UMEA 3318-1 tRNA-Cys
  2325. Escherichia coli UMEA 3323-1 tRNA-Cys
  2326. Escherichia coli UMEA 3329-1 tRNA-Cys
  2327. Escherichia coli UMEA 3336-1 tRNA-Cys
  2328. Escherichia coli UMEA 3337-1 tRNA-Cys
  2329. Escherichia coli UMEA 3341-1 tRNA-Cys
  2330. Escherichia coli UMEA 3342-1 tRNA-Cys
  2331. Escherichia coli UMEA 3355-1 tRNA-Cys
  2332. Escherichia coli UMEA 3391-1 tRNA-Cys
  2333. Escherichia coli UMEA 3426-1 tRNA-Cys
  2334. Escherichia coli UMEA 3489-1 tRNA-Cys
  2335. Escherichia coli UMEA 3490-1 tRNA-Cys
  2336. Escherichia coli UMEA 3585-1 tRNA-Cys
  2337. Escherichia coli UMEA 3592-1 tRNA-Cys
  2338. Escherichia coli UMEA 3609-1 tRNA-Cys
  2339. Escherichia coli UMEA 3617-1 tRNA-Cys
  2340. Escherichia coli UMEA 3632-1 tRNA-Cys
  2341. Escherichia coli UMEA 3652-1 tRNA-Cys
  2342. Escherichia coli UMEA 3656-1 tRNA-Cys
  2343. Escherichia coli UMEA 3662-1 tRNA-Cys
  2344. Escherichia coli UMEA 3671-1 tRNA-Cys
  2345. Escherichia coli UMEA 3682-1 tRNA-Cys
  2346. Escherichia coli UMEA 3687-1 tRNA-Cys
  2347. Escherichia coli UMEA 3693-1 tRNA-Cys
  2348. Escherichia coli UMEA 3694-1 tRNA-Cys
  2349. Escherichia coli UMEA 3702-1 tRNA-Cys
  2350. Escherichia coli UMEA 3703-1 tRNA-Cys
  2351. Escherichia coli UMEA 3705-1 tRNA-Cys
  2352. Escherichia coli UMEA 3707-1 tRNA-Cys
  2353. Escherichia coli UMEA 3718-1 tRNA-Cys
  2354. Escherichia coli UMEA 3805-1 tRNA-Cys
  2355. Escherichia coli UMEA 3821-1 tRNA-Cys
  2356. Escherichia coli UMEA 3834-1 tRNA-Cys
  2357. Escherichia coli UMEA 3889-1 tRNA-Cys
  2358. Escherichia coli UMEA 3893-1 tRNA-Cys
  2359. Escherichia coli UMEA 3899-1 tRNA-Cys
  2360. Escherichia coli UMEA 3955-1 tRNA-Cys
  2361. Escherichia coli UMEA 4075-1 tRNA-Cys
  2362. Escherichia coli UMEA 4076-1 tRNA-Cys
  2363. Escherichia coli UMEA 4207-1 tRNA-Cys
  2364. Escherichia coli UMN026 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2365. Escherichia coli UMNF18 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2366. Escherichia coli UMNK88 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2367. Escherichia coli UTI89 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2368. Escherichia coli VL2732 tRNA-Cys
  2369. Escherichia coli VL2874 tRNA-Cys
  2370. Escherichia coli VR50 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2371. Escherichia coli W26 tRNA-Cys
  2372. Escherichia coli W tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2373. Escherichia coli XH001 tRNA-Cys
  2374. Escherichia coli XH140A tRNA-Cys
  2375. Escherichia coli Xuzhou21 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2376. Escherichia fergusonii ATCC 35469 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2377. Escherichia fergusonii B253 tRNA-Cys
  2378. Escherichia fergusonii tRNA-Cys(gca)
  2379. Escherichia marmotae tRNA-Cys(gca)
  2380. Escherichia ruysiae tRNA-Cys
  2381. Escherichia sp. 0.2392 tRNA-Cys
  2382. Escherichia sp. 11.1596 tRNA-Cys
  2383. Escherichia sp. 11.1597 tRNA-Cys
  2384. Escherichia sp. 11.1600 tRNA-Cys
  2385. Escherichia sp. 1_1_43 tRNA-Cys
  2386. Escherichia sp. 12.2610 tRNA-Cys
  2387. Escherichia sp. 12.2612 tRNA-Cys
  2388. Escherichia sp. 14.0982 tRNA-Cys
  2389. Escherichia sp. 14.0985 tRNA-Cys
  2390. Escherichia sp. 20412-1 tRNA-Cys
  2391. Escherichia sp. 4_1_40B tRNA-Cys
  2392. Escherichia sp. 4726-5 tRNA-Cys
  2393. Escherichia sp. 79.0191 tRNA-Cys
  2394. Escherichia sp. 8.2195 tRNA-Cys
  2395. Escherichia sp. 92.1228 tRNA-Cys
  2396. Escherichia sp. 93.0724 tRNA-Cys
  2397. Escherichia sp. 93.0743 tRNA-Cys
  2398. Escherichia sp. 93.0750 tRNA-Cys
  2399. Escherichia sp. 93.0816 tRNA-Cys
  2400. Escherichia sp. 93.1447 tRNA-Cys
  2401. Escherichia sp. 93.1462 tRNA-Cys
  2402. Escherichia sp. 93.1518 tRNA-Cys
  2403. Escherichia sp. 94.0001 tRNA-Cys
  2404. Escherichia sp. E10V10 tRNA-Cys
  2405. Escherichia sp. E10V4 tRNA-Cys
  2406. Escherichia sp. E10V5 tRNA-Cys
  2407. Escherichia sp. E1130 tRNA-Cys
  2408. Escherichia sp. E13S3 tRNA-Cys
  2409. Escherichia sp. E14S1 tRNA-Cys
  2410. Escherichia sp. E14V10 tRNA-Cys
  2411. Escherichia sp. E14V5 tRNA-Cys
  2412. Escherichia sp. E14V7 tRNA-Cys
  2413. Escherichia sp. E1S7 tRNA-Cys
  2414. Escherichia sp. E1V33 tRNA-Cys
  2415. Escherichia sp. E2562 tRNA-Cys
  2416. Escherichia sp. E2586 tRNA-Cys
  2417. Escherichia sp. E2593 tRNA-Cys
  2418. Escherichia sp. E2661 tRNA-Cys
  2419. Escherichia sp. E2748 tRNA-Cys
  2420. Escherichia sp. E3356 tRNA-Cys
  2421. Escherichia sp. E3659 tRNA-Cys
  2422. Escherichia sp. E4208 tRNA-Cys
  2423. Escherichia sp. E4385 tRNA-Cys
  2424. Escherichia sp. E4694 tRNA-Cys
  2425. Escherichia sp. E4702 tRNA-Cys
  2426. Escherichia sp. E4736 tRNA-Cys
  2427. Escherichia sp. E4742 tRNA-Cys
  2428. Escherichia sp. E4930 tRNA-Cys
  2429. Escherichia sp. E5028 tRNA-Cys
  2430. Escherichia sp. Gen1 tRNA-Cys
  2431. Escherichia sp. HH26CH tRNA-Cys
  2432. Escherichia sp. HH41S tRNA-Cys
  2433. Escherichia sp. JL983 tRNA-Cys
  2434. Escherichia sp. KCJ4928 tRNA-Cys
  2435. Escherichia sp. KCJ4943 tRNA-Cys
  2436. Escherichia sp. KTE114 tRNA-Cys
  2437. Escherichia sp. KTE11 tRNA-Cys
  2438. Escherichia sp. KTE159 tRNA-Cys
  2439. Escherichia sp. KTE172 tRNA-Cys
  2440. Escherichia sp. KTE31 tRNA-Cys
  2441. Escherichia sp. KTE52 tRNA-Cys
  2442. Escherichia sp. KTE96 tRNA-Cys
  2443. Escherichia sp. MOD1-EC5451 tRNA-Cys
  2444. Escherichia sp. MOD1-EC6475 tRNA-Cys
  2445. Escherichia sp. MR tRNA-Cys
  2446. Escherichia sp. NIC32-2 tRNA-Cys
  2447. Escherichia sp. NIC4-1 tRNA-Cys
  2448. Escherichia sp. NT45 tRNA-Cys
  2449. Escherichia sp. R8 tRNA-Cys
  2450. Escherichia sp. S2_ASV_4 tRNA-Cys
  2451. Escherichia sp. S69_ASV_4 tRNA-Cys
  2452. Escherichia sp. S85_ASV_4 tRNA-Cys
  2453. Escherichia whittamii tRNA-Cys
  2454. Escherichia sp. SCLE84 tRNA-Cys
  2455. Escherichia sp. TC-EC600-tetX4 tRNA-Cys
  2456. Escherichia sp. TM-G17TGC tRNA-Cys
  2457. Escherichia sp. tRNA-Cys
  2458. Ewingella americana ATCC 33852 tRNA-Cys
  2459. Ewingella americana tRNA-Cys
  2460. Ewingella sp. tRNA-Cys
  2461. Gibbsiella quercinecans tRNA-Cys
  2462. Hafnia alvei ATCC 51873 tRNA-Cys
  2463. Hafnia alvei tRNA-Cys
  2464. Hafnia paralvei ATCC 29927 tRNA-Cys
  2465. Hafnia paralvei (metagenome) tRNA-Cys
  2466. Hafnia sp. HMSC23F03 tRNA-Cys
  2467. Klebsiella oxytoca tRNA-Cys(gca)
  2468. Klebsiella pneumoniae tRNA-Cys(gca)
  2469. Klebsiella quasipneumoniae subsp. similipneumoniae tRNA-Cys
  2470. Listeria monocytogenes tRNA-Cys
  2471. Mangrovibacter phragmitis tRNA-Cys
  2472. Obesumbacterium proteus ATCC 12841 tRNA-Cys
  2473. Obesumbacterium proteus tRNA-Cys
  2474. Pectobacterium aquaticum tRNA-Cys
  2475. Pectobacterium aroidearum tRNA-Cys
  2476. Pectobacterium atrosepticum ICMP 1526 tRNA-Cys
  2477. Pectobacterium atrosepticum SCRI1043 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2478. Pectobacterium atrosepticum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2479. Pectobacterium betavasculorum tRNA-Cys
  2480. Pectobacterium cacticida tRNA-Cys
  2481. Pectobacterium carotovorum (Erwinia carotovora) tRNA-Cys
  2482. Pectobacterium actinidiae tRNA-Cys
  2483. Pectobacterium brasiliense tRNA-Cys
  2484. Pectobacterium brasiliense ICMP 19477 tRNA-Cys
  2485. Pectobacterium carotovorum subsp. carotovorum ICMP 5702 tRNA-Cys
  2486. Pectobacterium carotovorum subsp. carotovorum PC1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2487. Pectobacterium carotovorum subsp. carotovorum PCC21 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2488. Pectobacterium carotovorum subsp. carotovorum tRNA-Cys
  2489. Pectobacterium carotovorum subsp. carotovorum UGC32 tRNA-Cys
  2490. Pectobacterium colocasium tRNA-Cys
  2491. Pectobacterium jejuense tRNA-Cys
  2492. Pectobacterium odoriferum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2493. Pectobacterium parvum tRNA-Cys
  2494. Pectobacterium peruviense tRNA-Cys
  2495. Pectobacterium polaris tRNA-Cys
  2496. Pectobacterium polonicum tRNA-Cys
  2497. Pectobacterium punjabense tRNA-Cys
  2498. Pectobacterium quasiaquaticum tRNA-Cys
  2499. Pectobacterium sp. 21LCBS03 tRNA-Cys
  2500. Pectobacterium quasiaquaticum tRNA-Cys
  2501. Pectobacterium sp. A5351 tRNA-Cys
  2502. Pectobacterium sp. CFBP8739 tRNA-Cys
  2503. Pectobacterium sp. F1-1 tRNA-Cys
  2504. Pectobacterium versatile tRNA-Cys
  2505. Pectobacterium zantedeschiae tRNA-Cys
  2506. Prevotella sp. tRNA-Cys
  2507. Pseudomonas lundensis tRNA-Cys
  2508. Pseudomonas reactans tRNA-Cys
  2509. Salmonella bongori CFSAN000510 tRNA-Cys
  2510. Salmonella bongori N268-08 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2511. Salmonella bongori NCTC 12419 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2512. Salmonella bongori serovar 40:z35:- str. 95-0123 tRNA-Cys
  2513. Salmonella bongori serovar 40:z35:- tRNA-Cys
  2514. Salmonella bongori serovar 44:r:- tRNA-Cys
  2515. Salmonella bongori serovar 48:i:- str. 94-0708 tRNA-Cys
  2516. Salmonella bongori serovar 48:i:- tRNA-Cys
  2517. Salmonella bongori serovar 48:z35:- tRNA-Cys
  2518. Salmonella bongori serovar 48:z41:-- str. RKS3044 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2519. Salmonella bongori serovar 66:z41:- str. SA19983605 tRNA-Cys
  2520. Salmonella bongori serovar 66:z65:- tRNA-Cys
  2521. Salmonella bongori tRNA-Cys(gca)
  2522. Salmonella enterica subsp. arizonae serovar [1],13,23:g,z51:- tRNA-Cys
  2523. Salmonella enterica subsp. arizonae serovar 13,22:z4,z23:- tRNA-Cys
  2524. Salmonella enterica subsp. arizonae serovar 13,23:gz51:- tRNA-Cys
  2525. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32450 tRNA-Cys
  2526. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 32457 tRNA-Cys
  2527. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43478 tRNA-Cys
  2528. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43479 tRNA-Cys
  2529. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43480 tRNA-Cys
  2530. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43481 tRNA-Cys
  2531. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM 43482 tRNA-Cys
  2532. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18383 tRNA-Cys
  2533. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18503 tRNA-Cys
  2534. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N18554 tRNA-Cys
  2535. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N20028 tRNA-Cys
  2536. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N23850 tRNA-Cys
  2537. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N25373 tRNA-Cys
  2538. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26624 tRNA-Cys
  2539. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26625 tRNA-Cys
  2540. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26626 tRNA-Cys
  2541. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N26928 tRNA-Cys
  2542. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N27 tRNA-Cys
  2543. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N29354 tRNA-Cys
  2544. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N31597 tRNA-Cys
  2545. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N4410 tRNA-Cys
  2546. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N5 tRNA-Cys
  2547. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N6509 tRNA-Cys
  2548. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N7307 tRNA-Cys
  2549. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- str. CVM N9135 tRNA-Cys
  2550. Salmonella enterica subsp. arizonae serovar 18:z4,z23:- tRNA-Cys
  2551. Salmonella enterica subsp. arizonae serovar 18:z4,z32:- tRNA-Cys
  2552. Salmonella enterica subsp. arizonae serovar 21:z4,z23:- tRNA-Cys
  2553. Salmonella enterica subsp. arizonae serovar 35:z4,z32:- tRNA-Cys
  2554. Salmonella enterica subsp. arizonae serovar 38:z4,z23:- tRNA-Cys
  2555. Salmonella enterica subsp. arizonae serovar 40:z36:- tRNA-Cys
  2556. Salmonella enterica subsp. arizonae serovar 40:z4,z23:- tRNA-Cys
  2557. Salmonella enterica subsp. arizonae serovar 40:z4,z24: tRNA-Cys
  2558. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- str. 01-0089 tRNA-Cys
  2559. Salmonella enterica subsp. arizonae serovar 41:z4,z23:- tRNA-Cys
  2560. Salmonella enterica subsp. arizonae serovar 41:z4,z32:- tRNA-Cys
  2561. Salmonella enterica subsp. arizonae serovar 44:z4,z23,z32:- tRNA-Cys
  2562. Salmonella enterica subsp. arizonae serovar 47:z4,z23:- tRNA-Cys
  2563. Salmonella enterica subsp. arizonae serovar 48:z4,z23:- tRNA-Cys
  2564. Salmonella enterica subsp. arizonae serovar 48:z4,z24:- tRNA-Cys
  2565. Salmonella enterica subsp. arizonae serovar 50:r:z tRNA-Cys
  2566. Salmonella enterica subsp. arizonae serovar 51:g,z51:- tRNA-Cys
  2567. Salmonella enterica subsp. arizonae serovar 53:-:- str. SA20100345 tRNA-Cys
  2568. Salmonella enterica subsp. arizonae serovar 56:z4,z23:- tRNA-Cys
  2569. Salmonella enterica subsp. arizonae serovar 62:z36:- str. 5335/86 tRNA-Cys
  2570. Salmonella enterica subsp. arizonae serovar 62:z36:- str. RKS2983 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2571. Salmonella enterica subsp. arizonae serovar 62:z36:- tRNA-Cys
  2572. Salmonella enterica subsp. arizonae serovar 62:z4,z23:- tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2573. Salmonella enterica subsp. arizonae serovar 63:g,z51:- str. So 20/20 tRNA-Cys
  2574. Salmonella enterica subsp. arizonae serovar 63:g,z51:- tRNA-Cys
  2575. Salmonella enterica subsp. arizonae str. CFSAN000560 tRNA-Cys
  2576. Salmonella enterica subsp. arizonae tRNA-Cys(gca)
  2577. Salmonella enterica subsp. diarizonae serovar 11:k:z53 tRNA-Cys
  2578. Salmonella enterica subsp. diarizonae serovar 16:z10:e,n,x,z15 tRNA-Cys
  2579. Salmonella enterica subsp. diarizonae serovar 17:z10:e,n,x,z15 tRNA-Cys
  2580. Salmonella enterica subsp. diarizonae serovar 35:k:e,n,x,z15 tRNA-Cys
  2581. Salmonella enterica subsp. diarizonae serovar 38:[k]:- tRNA-Cys
  2582. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35 tRNA-Cys
  2583. Salmonella enterica subsp. diarizonae serovar 38:[k]:z35:- tRNA-Cys
  2584. Salmonella enterica subsp. diarizonae serovar 38:k:z tRNA-Cys
  2585. Salmonella enterica subsp. diarizonae serovar 47:k:z35 tRNA-Cys
  2586. Salmonella enterica subsp. diarizonae serovar 47:k:z53:[z84] tRNA-Cys
  2587. Salmonella enterica subsp. diarizonae serovar 48:i:z tRNA-Cys
  2588. Salmonella enterica subsp. diarizonae serovar 48:z52:z tRNA-Cys
  2589. Salmonella enterica subsp. diarizonae serovar 50:k:z str. MZ0080 tRNA-Cys
  2590. Salmonella enterica subsp. diarizonae serovar 50:k:z tRNA-Cys
  2591. Salmonella enterica subsp. diarizonae serovar 50:k:z:[z50],[z57],[z68], [z86] tRNA-Cys
  2592. Salmonella enterica subsp. diarizonae serovar 50:l,v:z35 tRNA-Cys
  2593. Salmonella enterica subsp. diarizonae serovar 50:r:z tRNA-Cys
  2594. Salmonella enterica subsp. diarizonae serovar 50:z:- tRNA-Cys
  2595. Salmonella enterica subsp. diarizonae serovar 50:z:z52 tRNA-Cys
  2596. Salmonella enterica subsp. diarizonae serovar 53:r:z35 tRNA-Cys
  2597. Salmonella enterica subsp. diarizonae serovar 53:z10:- tRNA-Cys
  2598. Salmonella enterica subsp. diarizonae serovar 59:[k]:z35 tRNA-Cys
  2599. Salmonella enterica subsp. diarizonae serovar 59:z10:- tRNA-Cys
  2600. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 str. 01-0170 tRNA-Cys
  2601. Salmonella enterica subsp. diarizonae serovar 60:r:e,n,x,z15 tRNA-Cys
  2602. Salmonella enterica subsp. diarizonae serovar 61:-:1,5,7 tRNA-Cys
  2603. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,7 tRNA-Cys
  2604. Salmonella enterica subsp. diarizonae serovar 61:k:1,5,(7) tRNA-Cys
  2605. Salmonella enterica subsp. diarizonae serovar 61:l,v:1,5,7 tRNA-Cys
  2606. Salmonella enterica subsp. diarizonae serovar 61:l,[v],[z13]:1,5,[7] tRNA-Cys
  2607. Salmonella enterica subsp. diarizonae serovar 61:l,v:z35 tRNA-Cys
  2608. Salmonella enterica subsp. diarizonae serovar 61:r:z53 tRNA-Cys
  2609. Salmonella enterica subsp. diarizonae serovar 61:r:z tRNA-Cys
  2610. Salmonella enterica subsp. diarizonae serovar 61:z52:z53 tRNA-Cys
  2611. Salmonella enterica subsp. diarizonae serovar 65:c:z str. SA20044251 tRNA-Cys
  2612. Salmonella enterica subsp. diarizonae serovar 65:(k):z tRNA-Cys
  2613. Salmonella enterica subsp. diarizonae serovar 65:z10:e,n,x,z15 tRNA-Cys
  2614. Salmonella enterica subsp. diarizonae serovar b,50:-:- tRNA-Cys
  2615. Salmonella enterica subsp. diarizonae serovar Rough:r:z tRNA-Cys
  2616. Salmonella enterica subsp. diarizonae serovar Rough:-:- tRNA-Cys
  2617. Salmonella enterica subsp. diarizonae str. CFSAN000553 tRNA-Cys
  2618. Salmonella enterica subsp. diarizonae str. CFSAN000558 tRNA-Cys
  2619. Salmonella enterica subsp. diarizonae tRNA-Cys(gca)
  2620. Salmonella enterica subsp. enterica serovar 11:r:- tRNA-Cys
  2621. Salmonella enterica subsp. enterica serovar 1,3,19:g,m,t:- tRNA-Cys
  2622. Salmonella enterica subsp. enterica serovar 13,23:b:- tRNA-Cys
  2623. Salmonella enterica subsp. enterica serovar 13,23:i:- tRNA-Cys
  2624. Salmonella enterica subsp. enterica serovar 1,4,12,27:b:- tRNA-Cys
  2625. Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- tRNA-Cys
  2626. Salmonella enterica subsp. enterica serovar 1,4,5,12:i:- tRNA-Cys
  2627. Salmonella enterica subsp. enterica serovar 16:b:- tRNA-Cys
  2628. Salmonella enterica subsp. enterica serovar 1,9,12:-:- tRNA-Cys
  2629. Salmonella enterica subsp. enterica serovar 28:e,h:z6 tRNA-Cys
  2630. Salmonella enterica subsp. enterica serovar 3,10:e,h:- tRNA-Cys
  2631. Salmonella enterica subsp. enterica serovar 4,12:d:- tRNA-Cys
  2632. Salmonella enterica subsp. enterica serovar 4,12:i:- tRNA-Cys
  2633. Salmonella enterica subsp. enterica serovar 4,12:r:- tRNA-Cys
  2634. Salmonella enterica subsp. enterica serovar 4:-:1,2 tRNA-Cys
  2635. Salmonella enterica subsp. enterica serovar 43:a:1,7 tRNA-Cys
  2636. Salmonella enterica subsp. enterica serovar 44:z10:1,7 tRNA-Cys
  2637. Salmonella enterica subsp. enterica serovar 4,5,12,27:- tRNA-Cys
  2638. Salmonella enterica subsp. enterica serovar 4,[5],12:b:- tRNA-Cys
  2639. Salmonella enterica subsp. enterica serovar 4,5,12:b:- tRNA-Cys
  2640. Salmonella enterica subsp. enterica serovar 4,[5],12:d:- tRNA-Cys
  2641. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1700 tRNA-Cys
  2642. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1736 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2643. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. 08-1739 tRNA-Cys
  2644. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- str. CVM23701 tRNA-Cys
  2645. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Cys
  2646. Salmonella enterica subsp. enterica serovar 4,[5],12:i:- tRNA-Cys
  2647. Salmonella enterica subsp. enterica serovar 4,5,12:i tRNA-Cys
  2648. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Cys
  2649. Salmonella enterica subsp. enterica serovar 4,5,12:i:- tRNA-Cys
  2650. Salmonella enterica subsp. enterica serovar 4,[5],12:r:- tRNA-Cys
  2651. Salmonella enterica subsp. enterica serovar 4,[5],12:- tRNA-Cys
  2652. Salmonella enterica subsp. enterica serovar 4,5:i:- tRNA-Cys
  2653. Salmonella enterica subsp. enterica serovar 47:z4,z23:- tRNA-Cys
  2654. Salmonella enterica subsp. enterica serovar 4:i:- tRNA-Cys
  2655. Salmonella enterica subsp. enterica serovar [5],12,[27]:d:- tRNA-Cys
  2656. Salmonella enterica subsp. enterica serovar 51:z:1,5 tRNA-Cys
  2657. Salmonella enterica subsp. enterica serovar 61:l,v:1,5 tRNA-Cys
  2658. Salmonella enterica subsp. enterica serovar 6,7,[14]:-:1,5 tRNA-Cys
  2659. Salmonella enterica subsp. enterica serovar 6,7,14:g,m[p],s:[1,2,7] tRNA-Cys
  2660. Salmonella enterica subsp. enterica serovar 6,7,[14]:r:- tRNA-Cys
  2661. Salmonella enterica subsp. enterica serovar 6,7:-:1,5 tRNA-Cys
  2662. Salmonella enterica subsp. enterica serovar 6,7:-1,5 tRNA-Cys
  2663. Salmonella enterica subsp. enterica serovar 6,7:b:- tRNA-Cys
  2664. Salmonella enterica subsp. enterica serovar 6,7:c:1,5 tRNA-Cys
  2665. Salmonella enterica subsp. enterica serovar 6,7:e,h:- tRNA-Cys
  2666. Salmonella enterica subsp. enterica serovar 6,7:k:- tRNA-Cys
  2667. Salmonella enterica subsp. enterica serovar 6,7:l,v:- tRNA-Cys
  2668. Salmonella enterica subsp. enterica serovar 6,7:-:l,w tRNA-Cys
  2669. Salmonella enterica subsp. enterica serovar 6,7:-:- tRNA-Cys
  2670. Salmonella enterica subsp. enterica serovar 6,8:-:1,2 tRNA-Cys
  2671. Salmonella enterica subsp. enterica serovar 6,8,20:d- tRNA-Cys
  2672. Salmonella enterica subsp. enterica serovar 6,8:d:- tRNA-Cys
  2673. Salmonella enterica subsp. enterica serovar 6,8:i:- tRNA-Cys
  2674. Salmonella enterica subsp. enterica serovar 7:d:z35 tRNA-Cys
  2675. Salmonella enterica subsp. enterica serovar 8,(20):i:- tRNA-Cys
  2676. Salmonella enterica subsp. enterica serovar 8,(20):-:z6 tRNA-Cys
  2677. Salmonella enterica subsp. enterica serovar 9,12-:1,5 tRNA-Cys
  2678. Salmonella enterica subsp. enterica serovar 9,12:-:1,5 tRNA-Cys
  2679. Salmonella enterica subsp. enterica serovar 9,12:g,m:- tRNA-Cys
  2680. Salmonella enterica subsp. enterica serovar 9,12:l,v:- str. 94293 tRNA-Cys
  2681. Salmonella enterica subsp. enterica serovar 9,12:l,z28:- tRNA-Cys
  2682. Salmonella enterica subsp. enterica serovar 9,12:- tRNA-Cys
  2683. Salmonella enterica subsp. enterica serovar 9,12:-:- tRNA-Cys
  2684. Salmonella enterica subsp. enterica serovar Abaetetuba str. ATCC 35640 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2685. Salmonella enterica subsp. enterica serovar Abaetetuba tRNA-Cys
  2686. Salmonella enterica subsp. enterica serovar Aba tRNA-Cys
  2687. Salmonella enterica subsp. enterica serovar Abeokuta tRNA-Cys
  2688. Salmonella enterica subsp. enterica serovar Aberdeen tRNA-Cys(gca)
  2689. Salmonella enterica subsp. enterica serovar Abony str. 0014 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2690. Salmonella enterica subsp. enterica serovar Abony tRNA-Cys
  2691. Salmonella enterica subsp. enterica serovar Abortusequi tRNA-Cys
  2692. Salmonella enterica subsp. enterica serovar Abortusovis tRNA-Cys
  2693. Salmonella enterica subsp. enterica serovar Adabraka tRNA-Cys
  2694. Salmonella enterica subsp. enterica serovar Adamstua tRNA-Cys
  2695. Salmonella enterica subsp. enterica serovar Adelaide str. A4-669 tRNA-Cys
  2696. Salmonella enterica subsp. enterica serovar Adelaide tRNA-Cys
  2697. Salmonella enterica subsp. enterica serovar Aderike tRNA-Cys
  2698. Salmonella enterica subsp. enterica serovar Adjame tRNA-Cys
  2699. Salmonella enterica subsp. enterica serovar Afula tRNA-Cys
  2700. Salmonella enterica subsp. enterica serovar Agama tRNA-Cys
  2701. Salmonella enterica subsp. enterica serovar Agbeni tRNA-Cys
  2702. Salmonella enterica subsp. enterica serovar Agona str. 0292 tRNA-Cys
  2703. Salmonella enterica subsp. enterica serovar Agona str. 0322 tRNA-Cys
  2704. Salmonella enterica subsp. enterica serovar Agona str. 241981 tRNA-Cys
  2705. Salmonella enterica subsp. enterica serovar Agona str. 24249 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2706. Salmonella enterica subsp. enterica serovar Agona str. 246555-3 tRNA-Cys
  2707. Salmonella enterica subsp. enterica serovar Agona str. 266757-1 tRNA-Cys
  2708. Salmonella enterica subsp. enterica serovar Agona str. 311387-1 tRNA-Cys
  2709. Salmonella enterica subsp. enterica serovar Agona str. 339787 tRNA-Cys
  2710. Salmonella enterica subsp. enterica serovar Agona str. 392869-1 tRNA-Cys
  2711. Salmonella enterica subsp. enterica serovar Agona str. 392869-2 tRNA-Cys
  2712. Salmonella enterica subsp. enterica serovar Agona str. 400095 11 tRNA-Cys
  2713. Salmonella enterica subsp. enterica serovar Agona str. 400095 13 tRNA-Cys
  2714. Salmonella enterica subsp. enterica serovar Agona str. 400095 14 tRNA-Cys
  2715. Salmonella enterica subsp. enterica serovar Agona str. 400095 17 tRNA-Cys
  2716. Salmonella enterica subsp. enterica serovar Agona str. 400095 18 tRNA-Cys
  2717. Salmonella enterica subsp. enterica serovar Agona str. 400095 19 tRNA-Cys
  2718. Salmonella enterica subsp. enterica serovar Agona str. 400095 22 tRNA-Cys
  2719. Salmonella enterica subsp. enterica serovar Agona str. 400096 16 tRNA-Cys
  2720. Salmonella enterica subsp. enterica serovar Agona str. 400100 30-11 tRNA-Cys
  2721. Salmonella enterica subsp. enterica serovar Agona str. 400100 5-3 tRNA-Cys
  2722. Salmonella enterica subsp. enterica serovar Agona str. 400100 6-5 tRNA-Cys
  2723. Salmonella enterica subsp. enterica serovar Agona str. 400100 7-9 tRNA-Cys
  2724. Salmonella enterica subsp. enterica serovar Agona str. 409753-6 tRNA-Cys
  2725. Salmonella enterica subsp. enterica serovar Agona str. 419639 2-1 tRNA-Cys
  2726. Salmonella enterica subsp. enterica serovar Agona str. 432613 tRNA-Cys
  2727. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-4 tRNA-Cys
  2728. Salmonella enterica subsp. enterica serovar Agona str. 442692 2-5 tRNA-Cys
  2729. Salmonella enterica subsp. enterica serovar Agona str. 447967 1-1 tRNA-Cys
  2730. Salmonella enterica subsp. enterica serovar Agona str. 447967 2-1 tRNA-Cys
  2731. Salmonella enterica subsp. enterica serovar Agona str. 460004 1-1 tRNA-Cys
  2732. Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2733. Salmonella enterica subsp. enterica serovar Agona str. 467481 tRNA-Cys
  2734. Salmonella enterica subsp. enterica serovar Agona str. 557928 tRNA-Cys
  2735. Salmonella enterica subsp. enterica serovar Agona str. 620239 tRNA-Cys
  2736. Salmonella enterica subsp. enterica serovar Agona str. 632182-2 tRNA-Cys
  2737. Salmonella enterica subsp. enterica serovar Agona str. 648586-1 tRNA-Cys
  2738. Salmonella enterica subsp. enterica serovar Agona str. ATCC 51957 tRNA-Cys
  2739. Salmonella enterica subsp. enterica serovar Agona str. ATCC BAA-707 tRNA-Cys
  2740. Salmonella enterica subsp. enterica serovar Agona str. SA-1 tRNA-Cys
  2741. Salmonella enterica subsp. enterica serovar Agona str. SA-2 tRNA-Cys
  2742. Salmonella enterica subsp. enterica serovar Agona str. SA-3 tRNA-Cys
  2743. Salmonella enterica subsp. enterica serovar Agona str. SA-4 tRNA-Cys
  2744. Salmonella enterica subsp. enterica serovar Agona str. SA-5 tRNA-Cys
  2745. Salmonella enterica subsp. enterica serovar Agona str. SH08SF124 tRNA-Cys
  2746. Salmonella enterica subsp. enterica serovar Agona str. SH10GFN094 tRNA-Cys
  2747. Salmonella enterica subsp. enterica serovar Agona str. SH11G1113 tRNA-Cys
  2748. Salmonella enterica subsp. enterica serovar Agona str. SL483 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2749. Salmonella enterica subsp. enterica serovar Agona tRNA-Cys
  2750. Salmonella enterica subsp. enterica serovar Ago tRNA-Cys
  2751. Salmonella enterica subsp. enterica serovar Agoueve tRNA-Cys
  2752. Salmonella enterica subsp. enterica serovar Ahuza tRNA-Cys
  2753. Salmonella enterica subsp. enterica serovar Ajiobo tRNA-Cys
  2754. Salmonella enterica subsp. enterica serovar Akanji tRNA-Cys
  2755. Salmonella enterica subsp. enterica serovar Alabama tRNA-Cys
  2756. Salmonella enterica subsp. enterica serovar Alachua str. R6-377 tRNA-Cys
  2757. Salmonella enterica subsp. enterica serovar Alachua tRNA-Cys
  2758. Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 tRNA-Cys
  2759. Salmonella enterica subsp. enterica serovar Albany tRNA-Cys
  2760. Salmonella enterica subsp. enterica serovar Albert tRNA-Cys
  2761. Salmonella enterica subsp. enterica serovar Allandale tRNA-Cys
  2762. Salmonella enterica subsp. enterica serovar Altendorf tRNA-Cys
  2763. Salmonella enterica subsp. enterica serovar Altona tRNA-Cys
  2764. Salmonella enterica subsp. enterica serovar Amager tRNA-Cys
  2765. Salmonella enterica subsp. enterica serovar Amersfoort tRNA-Cys
  2766. Salmonella enterica subsp. enterica serovar Amoutive tRNA-Cys
  2767. Salmonella enterica subsp. enterica serovar Amsterdam tRNA-Cys
  2768. Salmonella enterica subsp. enterica serovar Amsterdam var. 15+,34+ tRNA-Cys
  2769. Salmonella enterica subsp. enterica serovar Anatum str. 0262 tRNA-Cys
  2770. Salmonella enterica subsp. enterica serovar Anatum str. ATCC BAA-1592 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2771. Salmonella enterica subsp. enterica serovar Anatum str. CDC 06-0532 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2772. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN000511 tRNA-Cys
  2773. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003945 tRNA-Cys
  2774. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003961 tRNA-Cys
  2775. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003962 tRNA-Cys
  2776. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003963 tRNA-Cys
  2777. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003964 tRNA-Cys
  2778. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003967 tRNA-Cys
  2779. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003970 tRNA-Cys
  2780. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003971 tRNA-Cys
  2781. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003972 tRNA-Cys
  2782. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003973 tRNA-Cys
  2783. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003974 tRNA-Cys
  2784. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN003975 tRNA-Cys
  2785. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004000 tRNA-Cys
  2786. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004001 tRNA-Cys
  2787. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004002 tRNA-Cys
  2788. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004004 tRNA-Cys
  2789. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004005 tRNA-Cys
  2790. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004010 tRNA-Cys
  2791. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004011 tRNA-Cys
  2792. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004012 tRNA-Cys
  2793. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004013 tRNA-Cys
  2794. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004014 tRNA-Cys
  2795. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004015 tRNA-Cys
  2796. Salmonella enterica subsp. enterica serovar Anatum str. CFSAN004017 tRNA-Cys
  2797. Salmonella enterica subsp. enterica serovar Anatum str. USDA 100 tRNA-Cys
  2798. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2799. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1676 tRNA-Cys
  2800. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1677 tRNA-Cys
  2801. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1727 tRNA-Cys
  2802. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1728 tRNA-Cys
  2803. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1735 tRNA-Cys
  2804. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1736 tRNA-Cys
  2805. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1765 tRNA-Cys
  2806. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1766 tRNA-Cys
  2807. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1781 tRNA-Cys
  2808. Salmonella enterica subsp. enterica serovar Anatum str. USDA-ARS-USMARC-1783 tRNA-Cys
  2809. Salmonella enterica subsp. enterica serovar Anatum tRNA-Cys
  2810. Salmonella enterica subsp. enterica serovar Anatum var. 15+ tRNA-Cys
  2811. Salmonella enterica subsp. enterica serovar Anderlecht tRNA-Cys
  2812. Salmonella enterica subsp. enterica serovar Anecho tRNA-Cys
  2813. Salmonella enterica subsp. enterica serovar Anfo tRNA-Cys
  2814. Salmonella enterica subsp. enterica serovar Angoda tRNA-Cys
  2815. Salmonella enterica subsp. enterica serovar Ank tRNA-Cys
  2816. Salmonella enterica subsp. enterica serovar Antsalova str. S01-0511 tRNA-Cys
  2817. Salmonella enterica subsp. enterica serovar Antsalova tRNA-Cys
  2818. Salmonella enterica subsp. enterica serovar Apapa str. SA20060561 tRNA-Cys
  2819. Salmonella enterica subsp. enterica serovar Apapa tRNA-Cys
  2820. Salmonella enterica subsp. enterica serovar Apeyeme tRNA-Cys
  2821. Salmonella enterica subsp. enterica serovar Aqua str. NVSL2001 tRNA-Cys
  2822. Salmonella enterica subsp. enterica serovar Arechavaleta tRNA-Cys
  2823. Salmonella enterica subsp. enterica serovar Arkansas tRNA-Cys
  2824. Salmonella enterica subsp. enterica serovar Aschersleben tRNA-Cys
  2825. Salmonella enterica subsp. enterica serovar Augustenborg tRNA-Cys
  2826. Salmonella enterica subsp. enterica serovar Austin tRNA-Cys
  2827. Salmonella enterica subsp. enterica serovar Babelsberg tRNA-Cys
  2828. Salmonella enterica subsp. enterica serovar Baguida tRNA-Cys
  2829. Salmonella enterica subsp. enterica serovar Bahati tRNA-Cys
  2830. Salmonella enterica subsp. enterica serovar Bahrenfeld tRNA-Cys
  2831. Salmonella enterica subsp. enterica serovar Baildon str. R6-199 tRNA-Cys
  2832. Salmonella enterica subsp. enterica serovar Baildon tRNA-Cys
  2833. Salmonella enterica subsp. enterica serovar Bakau tRNA-Cys
  2834. Salmonella enterica subsp. enterica serovar Ball tRNA-Cys
  2835. Salmonella enterica subsp. enterica serovar Banana tRNA-Cys
  2836. Salmonella enterica subsp. enterica serovar Bardo tRNA-Cys
  2837. Salmonella enterica subsp. enterica serovar Bareilly str. 2780 tRNA-Cys
  2838. Salmonella enterica subsp. enterica serovar Bareilly str. ATCC 9115 tRNA-Cys
  2839. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000178 tRNA-Cys
  2840. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000179 tRNA-Cys
  2841. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000180 tRNA-Cys
  2842. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000181 tRNA-Cys
  2843. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000182 tRNA-Cys
  2844. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000183 tRNA-Cys
  2845. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000184 tRNA-Cys
  2846. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000185 tRNA-Cys
  2847. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000186 tRNA-Cys
  2848. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000187 tRNA-Cys
  2849. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000188 tRNA-Cys
  2850. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000189 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2851. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000190 tRNA-Cys
  2852. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000191 tRNA-Cys
  2853. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000192 tRNA-Cys
  2854. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000193 tRNA-Cys
  2855. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000194 tRNA-Cys
  2856. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000195 tRNA-Cys
  2857. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000196 tRNA-Cys
  2858. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000197 tRNA-Cys
  2859. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000198 tRNA-Cys
  2860. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000199 tRNA-Cys
  2861. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000200 tRNA-Cys
  2862. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000201 tRNA-Cys
  2863. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000202 tRNA-Cys
  2864. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000203 tRNA-Cys
  2865. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000204 tRNA-Cys
  2866. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000205 tRNA-Cys
  2867. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000206 tRNA-Cys
  2868. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000207 tRNA-Cys
  2869. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000208 tRNA-Cys
  2870. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000209 tRNA-Cys
  2871. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000210 tRNA-Cys
  2872. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000211 tRNA-Cys
  2873. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000212 tRNA-Cys
  2874. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000213 tRNA-Cys
  2875. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000214 tRNA-Cys
  2876. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000215 tRNA-Cys
  2877. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000216 tRNA-Cys
  2878. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000217 tRNA-Cys
  2879. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000218 tRNA-Cys
  2880. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000219 tRNA-Cys
  2881. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000220 tRNA-Cys
  2882. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000221 tRNA-Cys
  2883. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000222 tRNA-Cys
  2884. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000223 tRNA-Cys
  2885. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000224 tRNA-Cys
  2886. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000225 tRNA-Cys
  2887. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000226 tRNA-Cys
  2888. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000227 tRNA-Cys
  2889. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000228 tRNA-Cys
  2890. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000229 tRNA-Cys
  2891. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000230 tRNA-Cys
  2892. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000231 tRNA-Cys
  2893. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000232 tRNA-Cys
  2894. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000233 tRNA-Cys
  2895. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000235 tRNA-Cys
  2896. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000236 tRNA-Cys
  2897. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000661 tRNA-Cys
  2898. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000662 tRNA-Cys
  2899. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 tRNA-Cys
  2900. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000680 tRNA-Cys
  2901. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000700 tRNA-Cys
  2902. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000752 tRNA-Cys
  2903. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000753 tRNA-Cys
  2904. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000754 tRNA-Cys
  2905. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000755 tRNA-Cys
  2906. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000951 tRNA-Cys
  2907. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000952 tRNA-Cys
  2908. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000953 tRNA-Cys
  2909. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000954 tRNA-Cys
  2910. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000955 tRNA-Cys
  2911. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000956 tRNA-Cys
  2912. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000957 tRNA-Cys
  2913. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000958 tRNA-Cys
  2914. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000959 tRNA-Cys
  2915. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000960 tRNA-Cys
  2916. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000961 tRNA-Cys
  2917. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000962 tRNA-Cys
  2918. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000963 tRNA-Cys
  2919. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000964 tRNA-Cys
  2920. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000965 tRNA-Cys
  2921. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000966 tRNA-Cys
  2922. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000967 tRNA-Cys
  2923. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000968 tRNA-Cys
  2924. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000969 tRNA-Cys
  2925. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000970 tRNA-Cys
  2926. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001087 tRNA-Cys
  2927. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001088 tRNA-Cys
  2928. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001089 tRNA-Cys
  2929. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001090 tRNA-Cys
  2930. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001099 tRNA-Cys
  2931. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001102 tRNA-Cys
  2932. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001105 tRNA-Cys
  2933. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001107 tRNA-Cys
  2934. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001108 tRNA-Cys
  2935. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001109 tRNA-Cys
  2936. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001111 tRNA-Cys
  2937. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001112 tRNA-Cys
  2938. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001114 tRNA-Cys
  2939. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001115 tRNA-Cys
  2940. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001117 tRNA-Cys
  2941. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001118 tRNA-Cys
  2942. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001140 tRNA-Cys
  2943. Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN001591 tRNA-Cys
  2944. Salmonella enterica subsp. enterica serovar Bareilly tRNA-Cys
  2945. Salmonella enterica subsp. enterica serovar Bargny tRNA-Cys
  2946. Salmonella enterica subsp. enterica serovar Barranquilla tRNA-Cys
  2947. Salmonella enterica subsp. enterica serovar Beaudesert tRNA-Cys
  2948. Salmonella enterica subsp. enterica serovar Belfast tRNA-Cys
  2949. Salmonella enterica subsp. enterica serovar Benin tRNA-Cys
  2950. Salmonella enterica subsp. enterica serovar Bere tRNA-Cys
  2951. Salmonella enterica subsp. enterica serovar Bergen str. ST350 tRNA-Cys
  2952. Salmonella enterica subsp. enterica serovar Bergen tRNA-Cys
  2953. Salmonella enterica subsp. enterica serovar Berkeley tRNA-Cys
  2954. Salmonella enterica subsp. enterica serovar Berlin tRNA-Cys
  2955. Salmonella enterica subsp. enterica serovar Berta str. ATCC 8392 tRNA-Cys
  2956. Salmonella enterica subsp. enterica serovar Berta str. SA20103550 tRNA-Cys
  2957. Salmonella enterica subsp. enterica serovar Berta tRNA-Cys
  2958. Salmonella enterica subsp. enterica serovar Bietri tRNA-Cys
  2959. Salmonella enterica subsp. enterica serovar Bijlmer tRNA-Cys
  2960. Salmonella enterica subsp. enterica serovar Binza tRNA-Cys
  2961. Salmonella enterica subsp. enterica serovar Birkenhead tRNA-Cys
  2962. Salmonella enterica subsp. enterica serovar Bispebjerg tRNA-Cys
  2963. Salmonella enterica subsp. enterica serovar Blegdam str. S-1824 tRNA-Cys
  2964. Salmonella enterica subsp. enterica serovar Blegdam tRNA-Cys
  2965. Salmonella enterica subsp. enterica serovar Blockley tRNA-Cys
  2966. Salmonella enterica subsp. enterica serovar Blukwa tRNA-Cys
  2967. Salmonella enterica subsp. enterica serovar Bochum tRNA-Cys
  2968. Salmonella enterica subsp. enterica serovar Bonariensis tRNA-Cys
  2969. Salmonella enterica subsp. enterica serovar Bonn tRNA-Cys
  2970. Salmonella enterica subsp. enterica serovar Borreze str. SA20041063 tRNA-Cys
  2971. Salmonella enterica subsp. enterica serovar Bovismorbificans str. 3114 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2972. Salmonella enterica subsp. enterica serovar Bovismorbificans str. Sal610 tRNA-Cys
  2973. Salmonella enterica subsp. enterica serovar Bovismorbificans subsp. enterica serovar Bovismorbificans tRNA-Cys(gca)
  2974. Salmonella enterica subsp. enterica serovar Bracknell tRNA-Cys
  2975. Salmonella enterica subsp. enterica serovar Braenderup str. ATCC BAA-664 tRNA-Cys
  2976. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN000756 tRNA-Cys
  2977. Salmonella enterica subsp. enterica serovar Braenderup str. CFSAN001745 tRNA-Cys
  2978. Salmonella enterica subsp. enterica serovar Braenderup tRNA-Cys(gca)
  2979. Salmonella enterica subsp. enterica serovar Brancaster tRNA-Cys
  2980. Salmonella enterica subsp. enterica serovar Brandenburg tRNA-Cys
  2981. Salmonella enterica subsp. enterica serovar Brazzaville tRNA-Cys
  2982. Salmonella enterica subsp. enterica serovar Breda tRNA-Cys
  2983. Salmonella enterica subsp. enterica serovar Bredeney str. CFSAN001080 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  2984. Salmonella enterica subsp. enterica serovar Bredeney tRNA-Cys(gca)
  2985. Salmonella enterica subsp. enterica serovar Breukelen tRNA-Cys
  2986. Salmonella enterica subsp. enterica serovar Brevik tRNA-Cys
  2987. Salmonella enterica subsp. enterica serovar Brijbhumi tRNA-Cys
  2988. Salmonella enterica subsp. enterica serovar Bristol tRNA-Cys
  2989. Salmonella enterica subsp. enterica serovar Bron tRNA-Cys
  2990. Salmonella enterica subsp. enterica serovar Bruck tRNA-Cys
  2991. Salmonella enterica subsp. enterica serovar Brunei tRNA-Cys
  2992. Salmonella enterica subsp. enterica serovar Buckeye tRNA-Cys
  2993. Salmonella enterica subsp. enterica serovar Bukavu tRNA-Cys
  2994. Salmonella enterica subsp. enterica serovar Butantan tRNA-Cys
  2995. Salmonella enterica subsp. enterica serovar Buzu tRNA-Cys
  2996. Salmonella enterica subsp. enterica serovar Cairina tRNA-Cys
  2997. Salmonella enterica subsp. enterica serovar Calabar tRNA-Cys
  2998. Salmonella enterica subsp. enterica serovar California tRNA-Cys
  2999. Salmonella enterica subsp. enterica serovar Canada tRNA-Cys
  3000. Salmonella enterica subsp. enterica serovar Cannstatt tRNA-Cys
  3001. Salmonella enterica subsp. enterica serovar Caracas tRNA-Cys
  3002. Salmonella enterica subsp. enterica serovar Cardoner tRNA-Cys
  3003. Salmonella enterica subsp. enterica serovar Carmel tRNA-Cys
  3004. Salmonella enterica subsp. enterica serovar Carno tRNA-Cys
  3005. Salmonella enterica subsp. enterica serovar Carrau tRNA-Cys
  3006. Salmonella enterica subsp. enterica serovar Cerro str. FSL R8-0235 tRNA-Cys
  3007. Salmonella enterica subsp. enterica serovar Cerro str. 5569 tRNA-Cys
  3008. Salmonella enterica subsp. enterica serovar Cerro str. 818 tRNA-Cys
  3009. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001587 tRNA-Cys
  3010. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001588 tRNA-Cys
  3011. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001589 tRNA-Cys
  3012. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001590 tRNA-Cys
  3013. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001669 tRNA-Cys
  3014. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001670 tRNA-Cys
  3015. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001671 tRNA-Cys
  3016. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001673 tRNA-Cys
  3017. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001674 tRNA-Cys
  3018. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001679 tRNA-Cys
  3019. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001680 tRNA-Cys
  3020. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001681 tRNA-Cys
  3021. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001690 tRNA-Cys
  3022. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001691 tRNA-Cys
  3023. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001692 tRNA-Cys
  3024. Salmonella enterica subsp. enterica serovar Cerro str. CFSAN001697 tRNA-Cys
  3025. Salmonella enterica subsp. enterica serovar Cerro subsp. enterica serovar Cerro tRNA-Cys
  3026. Salmonella enterica subsp. enterica serovar Chailey tRNA-Cys
  3027. Salmonella enterica subsp. enterica serovar Champaign tRNA-Cys
  3028. Salmonella enterica subsp. enterica serovar Chandans tRNA-Cys
  3029. Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 tRNA-Cys
  3030. Salmonella enterica subsp. enterica serovar Chester tRNA-Cys
  3031. Salmonella enterica subsp. enterica serovar Chicago tRNA-Cys
  3032. Salmonella enterica subsp. enterica serovar Chichester tRNA-Cys
  3033. Salmonella enterica subsp. enterica serovar Chincol tRNA-Cys
  3034. Salmonella enterica subsp. enterica serovar Chingola tRNA-Cys
  3035. Salmonella enterica subsp. enterica serovar Chittagong tRNA-Cys
  3036. Salmonella enterica subsp. enterica serovar Choleraesuis str. 0006 tRNA-Cys
  3037. Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 tRNA-Cys
  3038. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000514 tRNA-Cys
  3039. Salmonella enterica subsp. enterica serovar Choleraesuis str. CFSAN000515 tRNA-Cys
  3040. Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3041. Salmonella enterica subsp. enterica serovar Choleraesuis str. SCSA50 tRNA-Cys
  3042. Salmonella enterica subsp. enterica serovar Choleraesuis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3043. Salmonella enterica subsp. enterica serovar Chomedey tRNA-Cys
  3044. Salmonella enterica subsp. enterica serovar Clackamas tRNA-Cys
  3045. Salmonella enterica subsp. enterica serovar Coeln tRNA-Cys
  3046. Salmonella enterica subsp. enterica serovar Coleypark tRNA-Cys
  3047. Salmonella enterica subsp. enterica serovar Colindale tRNA-Cys
  3048. Salmonella enterica subsp. enterica serovar Colorado tRNA-Cys
  3049. Salmonella enterica subsp. enterica serovar Concord tRNA-Cys
  3050. Salmonella enterica subsp. enterica serovar Copenhagen tRNA-Cys
  3051. Salmonella enterica subsp. enterica serovar Coquilhatville tRNA-Cys
  3052. Salmonella enterica subsp. enterica serovar Corvallis tRNA-Cys
  3053. Salmonella enterica subsp. enterica serovar Cotham tRNA-Cys
  3054. Salmonella enterica subsp. enterica serovar Cremieu tRNA-Cys
  3055. Salmonella enterica subsp. enterica serovar Crossness str. 1422-74 tRNA-Cys
  3056. Salmonella enterica subsp. enterica serovar Cubana str. 76814 tRNA-Cys
  3057. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN001083 tRNA-Cys
  3058. Salmonella enterica subsp. enterica serovar Cubana str. CFSAN002050 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3059. Salmonella enterica subsp. enterica serovar Cubana str. CVM42234 tRNA-Cys
  3060. Salmonella enterica subsp. enterica serovar Cubana tRNA-Cys
  3061. Salmonella enterica subsp. enterica serovar Cullingworth tRNA-Cys
  3062. Salmonella enterica subsp. enterica serovar Curacao tRNA-Cys
  3063. Salmonella enterica subsp. enterica serovar Dabou tRNA-Cys
  3064. Salmonella enterica subsp. enterica serovar Daytona tRNA-Cys(gca)
  3065. Salmonella enterica subsp. enterica serovar Decatur tRNA-Cys
  3066. Salmonella enterica subsp. enterica serovar Denver tRNA-Cys
  3067. Salmonella enterica subsp. enterica serovar Derby str. 626 tRNA-Cys
  3068. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000564 tRNA-Cys
  3069. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000565 tRNA-Cys
  3070. Salmonella enterica subsp. enterica serovar Derby str. CFSAN000566 tRNA-Cys
  3071. Salmonella enterica subsp. enterica serovar Derby tRNA-Cys(gca)
  3072. Salmonella enterica subsp. enterica serovar Dessau tRNA-Cys
  3073. Salmonella enterica subsp. enterica serovar Diguel tRNA-Cys
  3074. Salmonella enterica subsp. enterica serovar Djakarta str. S-1087 tRNA-Cys
  3075. Salmonella enterica subsp. enterica serovar Djugu tRNA-Cys
  3076. Salmonella enterica subsp. enterica serovar Dublin str. 0773 tRNA-Cys
  3077. Salmonella enterica subsp. enterica serovar Dublin str. ATCC 39184 tRNA-Cys
  3078. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000517 tRNA-Cys
  3079. Salmonella enterica subsp. enterica serovar Dublin str. CFSAN000518 tRNA-Cys
  3080. Salmonella enterica subsp. enterica serovar Dublin str. CT_02021853 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3081. Salmonella enterica subsp. enterica serovar Dublin str. DG22 tRNA-Cys
  3082. Salmonella enterica subsp. enterica serovar Dublin str. SA20093032 tRNA-Cys
  3083. Salmonella enterica subsp. enterica serovar Dublin str. SD3246 tRNA-Cys
  3084. Salmonella enterica subsp. enterica serovar Dublin str. SL1438 tRNA-Cys
  3085. Salmonella enterica subsp. enterica serovar Dublin str. UC16 tRNA-Cys
  3086. Salmonella enterica subsp. enterica serovar Dublin tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3087. Salmonella enterica subsp. enterica serovar Duesseldorf tRNA-Cys
  3088. Salmonella enterica subsp. enterica serovar Dugbe tRNA-Cys
  3089. Salmonella enterica subsp. enterica serovar Duisburg tRNA-Cys
  3090. Salmonella enterica subsp. enterica serovar Durban tRNA-Cys
  3091. Salmonella enterica subsp. enterica serovar Durham tRNA-Cys
  3092. Salmonella enterica subsp. enterica serovar Ealing tRNA-Cys
  3093. Salmonella enterica subsp. enterica serovar Eastbourne str. CFSAN001084 tRNA-Cys
  3094. Salmonella enterica subsp. enterica serovar Eastbourne tRNA-Cys
  3095. Salmonella enterica subsp. enterica serovar Eboko tRNA-Cys
  3096. Salmonella enterica subsp. enterica serovar Eingedi tRNA-Cys
  3097. Salmonella enterica subsp. enterica serovar Ekotedo tRNA-Cys
  3098. Salmonella enterica subsp. enterica serovar Eko tRNA-Cys
  3099. Salmonella enterica subsp. enterica serovar Ekpoui tRNA-Cys
  3100. Salmonella enterica subsp. enterica serovar Elisabethville tRNA-Cys
  3101. Salmonella enterica subsp. enterica serovar Elomrane tRNA-Cys
  3102. Salmonella enterica subsp. enterica serovar Emek tRNA-Cys
  3103. Salmonella enterica subsp. enterica serovar Enteritidis str. 08-1080 tRNA-Cys
  3104. Salmonella enterica subsp. enterica serovar Enteritidis str. 10-34587 tRNA-Cys
  3105. Salmonella enterica subsp. enterica serovar Enteritidis str. 13183-1 tRNA-Cys
  3106. Salmonella enterica subsp. enterica serovar Enteritidis str. 13-1 tRNA-Cys
  3107. Salmonella enterica subsp. enterica serovar Enteritidis str. 17927 tRNA-Cys
  3108. Salmonella enterica subsp. enterica serovar Enteritidis str. 18569 tRNA-Cys
  3109. Salmonella enterica subsp. enterica serovar Enteritidis str. 20037 tRNA-Cys
  3110. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K0958 tRNA-Cys
  3111. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1651 tRNA-Cys
  3112. Salmonella enterica subsp. enterica serovar Enteritidis str. 2009K1726 tRNA-Cys
  3113. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0262 tRNA-Cys
  3114. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0267 tRNA-Cys
  3115. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0271 tRNA-Cys
  3116. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0284 tRNA-Cys
  3117. Salmonella enterica subsp. enterica serovar Enteritidis str. 2010K-0286 tRNA-Cys
  3118. Salmonella enterica subsp. enterica serovar Enteritidis str. 22510-1 tRNA-Cys
  3119. Salmonella enterica subsp. enterica serovar Enteritidis str. 22558 tRNA-Cys
  3120. Salmonella enterica subsp. enterica serovar Enteritidis str. 22704 tRNA-Cys
  3121. Salmonella enterica subsp. enterica serovar Enteritidis str. 33944 tRNA-Cys
  3122. Salmonella enterica subsp. enterica serovar Enteritidis str. 3402 tRNA-Cys
  3123. Salmonella enterica subsp. enterica serovar Enteritidis str. 436 tRNA-Cys
  3124. Salmonella enterica subsp. enterica serovar Enteritidis str. 485549-17 tRNA-Cys
  3125. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-3079 tRNA-Cys
  3126. Salmonella enterica subsp. enterica serovar Enteritidis str. 50-5646 tRNA-Cys
  3127. Salmonella enterica subsp. enterica serovar Enteritidis str. 53-407 tRNA-Cys
  3128. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 22-17 tRNA-Cys
  3129. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 40-18 tRNA-Cys
  3130. Salmonella enterica subsp. enterica serovar Enteritidis str. 543463 42-20 tRNA-Cys
  3131. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 1-1 tRNA-Cys
  3132. Salmonella enterica subsp. enterica serovar Enteritidis str. 561362 9-7 tRNA-Cys
  3133. Salmonella enterica subsp. enterica serovar Enteritidis str. 576709 tRNA-Cys
  3134. Salmonella enterica subsp. enterica serovar Enteritidis str. 58-6482 tRNA-Cys
  3135. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-22 tRNA-Cys
  3136. Salmonella enterica subsp. enterica serovar Enteritidis str. 596866-70 tRNA-Cys
  3137. Salmonella enterica subsp. enterica serovar Enteritidis str. 6.0562-1 tRNA-Cys
  3138. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-2 tRNA-Cys
  3139. Salmonella enterica subsp. enterica serovar Enteritidis str. 607307-6 tRNA-Cys
  3140. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-16 tRNA-Cys
  3141. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-19 tRNA-Cys
  3142. Salmonella enterica subsp. enterica serovar Enteritidis str. 607308-9 tRNA-Cys
  3143. Salmonella enterica subsp. enterica serovar Enteritidis str. 62-1976 tRNA-Cys
  3144. Salmonella enterica subsp. enterica serovar Enteritidis str. 622731-39 tRNA-Cys
  3145. Salmonella enterica subsp. enterica serovar Enteritidis str. 629163 tRNA-Cys
  3146. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-26 tRNA-Cys
  3147. Salmonella enterica subsp. enterica serovar Enteritidis str. 629164-37 tRNA-Cys
  3148. Salmonella enterica subsp. enterica serovar Enteritidis str. 635290-58 tRNA-Cys
  3149. Salmonella enterica subsp. enterica serovar Enteritidis str. 638970-15 tRNA-Cys
  3150. Salmonella enterica subsp. enterica serovar Enteritidis str. 639016-6 tRNA-Cys
  3151. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-46 tRNA-Cys
  3152. Salmonella enterica subsp. enterica serovar Enteritidis str. 639672-50 tRNA-Cys
  3153. Salmonella enterica subsp. enterica serovar Enteritidis str. 640631 tRNA-Cys
  3154. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 4-1 tRNA-Cys
  3155. Salmonella enterica subsp. enterica serovar Enteritidis str. 642044 8-1 tRNA-Cys
  3156. Salmonella enterica subsp. enterica serovar Enteritidis str. 642046 4-7 tRNA-Cys
  3157. Salmonella enterica subsp. enterica serovar Enteritidis str. 648898 4-5 tRNA-Cys
  3158. Salmonella enterica subsp. enterica serovar Enteritidis str. 648899 3-17 tRNA-Cys
  3159. Salmonella enterica subsp. enterica serovar Enteritidis str. 648900 1-16 tRNA-Cys
  3160. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 1-17 tRNA-Cys
  3161. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 16-16 tRNA-Cys
  3162. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 39-2 tRNA-Cys
  3163. Salmonella enterica subsp. enterica serovar Enteritidis str. 648901 6-18 tRNA-Cys
  3164. Salmonella enterica subsp. enterica serovar Enteritidis str. 648902 6-8 tRNA-Cys
  3165. Salmonella enterica subsp. enterica serovar Enteritidis str. 648903 1-6 tRNA-Cys
  3166. Salmonella enterica subsp. enterica serovar Enteritidis str. 648904 3-6 tRNA-Cys
  3167. Salmonella enterica subsp. enterica serovar Enteritidis str. 648905 5-18 tRNA-Cys
  3168. Salmonella enterica subsp. enterica serovar Enteritidis str. 653049 13-19 tRNA-Cys
  3169. Salmonella enterica subsp. enterica serovar Enteritidis str. 674470_11-10 tRNA-Cys
  3170. Salmonella enterica subsp. enterica serovar Enteritidis str. 76-2651 tRNA-Cys
  3171. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-0424 tRNA-Cys
  3172. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-1427 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3173. Salmonella enterica subsp. enterica serovar Enteritidis str. 77-2659 tRNA-Cys
  3174. Salmonella enterica subsp. enterica serovar Enteritidis str. 78-1757 tRNA-Cys
  3175. Salmonella enterica subsp. enterica serovar Enteritidis str. 81-2625 tRNA-Cys
  3176. Salmonella enterica subsp. enterica serovar Enteritidis str. 8b-1 tRNA-Cys
  3177. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0895 tRNA-Cys
  3178. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0899 tRNA-Cys
  3179. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0956 tRNA-Cys
  3180. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_0968 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3181. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1010 tRNA-Cys
  3182. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1018 tRNA-Cys
  3183. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1441 tRNA-Cys
  3184. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1444 tRNA-Cys
  3185. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1445 tRNA-Cys
  3186. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1455 tRNA-Cys
  3187. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1457 tRNA-Cys
  3188. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1543 tRNA-Cys
  3189. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1558 tRNA-Cys
  3190. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1559 tRNA-Cys
  3191. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1565 tRNA-Cys
  3192. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1566 tRNA-Cys
  3193. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1575 tRNA-Cys
  3194. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1580 tRNA-Cys
  3195. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1594 tRNA-Cys
  3196. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1725 tRNA-Cys
  3197. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1729 tRNA-Cys
  3198. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1745 tRNA-Cys
  3199. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1747 tRNA-Cys
  3200. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1791 tRNA-Cys
  3201. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1795 tRNA-Cys
  3202. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1808 tRNA-Cys
  3203. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1810 tRNA-Cys
  3204. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1811 tRNA-Cys
  3205. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1882 tRNA-Cys
  3206. Salmonella enterica subsp. enterica serovar Enteritidis str. CDC_2010K_1884 tRNA-Cys
  3207. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000052 tRNA-Cys
  3208. Salmonella enterica subsp. enterica serovar Enteritidis str. CFSAN000568 tRNA-Cys
  3209. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS44 tRNA-Cys
  3210. Salmonella enterica subsp. enterica serovar Enteritidis str. CHS4 tRNA-Cys
  3211. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_56-3991 tRNA-Cys
  3212. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_69-4941 tRNA-Cys
  3213. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_76-3618 tRNA-Cys
  3214. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_81-2490 tRNA-Cys
  3215. Salmonella enterica subsp. enterica serovar Enteritidis str. CVM_N202 tRNA-Cys
  3216. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090135 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3217. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090193 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3218. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090195 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3219. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090332 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3220. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090530 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3221. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090531 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3222. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090641 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3223. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090698 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3224. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20090884 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3225. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100088 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3226. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100089 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3227. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100100 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3228. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100101 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3229. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100103 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3230. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100130 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3231. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100131 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3232. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100134 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3233. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20100325 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3234. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110221 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3235. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110222 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3236. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110223 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3237. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110353 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3238. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110354 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3239. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110355 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3240. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110356 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3241. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110357 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3242. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110358 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3243. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110359 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3244. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110360 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3245. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20110361 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3246. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111095 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3247. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111174 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3248. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3249. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111510 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3250. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111514 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3251. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111515 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3252. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111554 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3253. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111561 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3254. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20111576 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3255. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3256. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120003 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3257. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120005 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3258. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120007 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3259. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120008 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3260. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120009 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3261. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120051 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3262. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120200 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3263. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120213 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3264. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120219 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3265. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120229 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3266. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120240 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3267. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120356 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3268. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120469 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3269. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120496 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3270. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120497 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3271. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120498 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3272. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120505 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3273. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120528 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3274. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120544 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3275. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120548 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3276. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120555 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3277. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120580 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3278. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120581 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3279. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120590 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3280. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120597 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3281. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120677 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3282. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120685 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3283. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120686 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3284. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120687 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3285. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120697 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3286. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120722 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3287. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120734 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3288. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120738 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3289. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120765 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3290. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120773 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3291. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120774 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3292. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120775 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3293. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120776 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3294. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120916 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3295. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120917 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3296. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120918 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3297. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120925 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3298. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120927 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3299. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120929 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3300. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120963 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3301. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120968 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3302. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120969 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3303. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120970 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3304. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120994 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3305. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121004 tRNA-Cys
  3306. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121175 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3307. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121176 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3308. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121177 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3309. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121178 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3310. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121179 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3311. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121180 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3312. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121541 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3313. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121542 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3314. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121671 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3315. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121672 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3316. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121689 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3317. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121744 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3318. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121746 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3319. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121747 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3320. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121748 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3321. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121750 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3322. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121751 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3323. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121753 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3324. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121765 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3325. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121812 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3326. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121825 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3327. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121826 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3328. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121969 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3329. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121970 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3330. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121976 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3331. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121986 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3332. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121989 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3333. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20121990 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3334. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122022 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3335. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122026 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3336. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122031 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3337. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122033 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3338. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20122045 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3339. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130345 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3340. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130346 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3341. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130347 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3342. Salmonella enterica subsp. enterica serovar Enteritidis str. EC20130348 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3343. Salmonella enterica subsp. enterica serovar Enteritidis str. P125109 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3344. Salmonella enterica subsp. enterica serovar Enteritidis str. PT23 tRNA-Cys
  3345. Salmonella enterica subsp. enterica serovar Enteritidis str. RM2968 tRNA-Cys
  3346. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19930684 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3347. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19940857 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3348. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19942384 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3349. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19943269 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3350. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19960848 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3351. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19961622 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3352. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970510 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3353. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19970769 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3354. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19971331 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3355. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19980677 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3356. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981522 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3357. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19981857 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3358. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19982831 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3359. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19983126 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3360. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19992322 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3361. Salmonella enterica subsp. enterica serovar Enteritidis str. SA19994216 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3362. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20082034 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3363. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083456 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3364. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20083636 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3365. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084384 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3366. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084644 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3367. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20084824 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3368. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20085285 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3369. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090419 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3370. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090435 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3371. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20090877 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3372. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20091739 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3373. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20092320 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3374. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093266 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3375. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093421 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3376. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093430 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3377. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093538 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3378. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093543 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3379. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093784 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3380. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093788 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3381. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093950 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3382. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20093977 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3383. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094079 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3384. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094177 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3385. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094301 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3386. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094350 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3387. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094352 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3388. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094383 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3389. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094389 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3390. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094521 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3391. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094642 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3392. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094682 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3393. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20094803 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3394. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095309 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3395. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20095440 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3396. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100239 tRNA-Cys
  3397. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20100349 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3398. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20121703 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3399. Salmonella enterica subsp. enterica serovar Enteritidis str. SA20123395 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3400. Salmonella enterica subsp. enterica serovar Enteritidis str. SARB17 tRNA-Cys
  3401. Salmonella enterica subsp. enterica serovar Enteritidis str. SE10 tRNA-Cys
  3402. Salmonella enterica subsp. enterica serovar Enteritidis str. SE15-1 tRNA-Cys
  3403. Salmonella enterica subsp. enterica serovar Enteritidis str. SE30663 tRNA-Cys
  3404. Salmonella enterica subsp. enterica serovar Enteritidis str. SE8a tRNA-Cys
  3405. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE001 tRNA-Cys
  3406. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE002 tRNA-Cys
  3407. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE003 tRNA-Cys
  3408. Salmonella enterica subsp. enterica serovar Enteritidis str. SHSE004 tRNA-Cys
  3409. Salmonella enterica subsp. enterica serovar Enteritidis str. SL909 tRNA-Cys
  3410. Salmonella enterica subsp. enterica serovar Enteritidis str. SL913 tRNA-Cys
  3411. Salmonella enterica subsp. enterica serovar Enteritidis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3412. Salmonella enterica subsp. enterica serovar Enugu tRNA-Cys
  3413. Salmonella enterica subsp. enterica serovar Eppendorf tRNA-Cys
  3414. Salmonella enterica subsp. enterica serovar Eschberg tRNA-Cys
  3415. Salmonella enterica subsp. enterica serovar Essen tRNA-Cys
  3416. Salmonella enterica subsp. enterica serovar Everleigh tRNA-Cys
  3417. Salmonella enterica subsp. enterica serovar Falkensee tRNA-Cys
  3418. Salmonella enterica subsp. enterica serovar Fallowfield tRNA-Cys
  3419. Salmonella enterica subsp. enterica serovar Fann tRNA-Cys
  3420. Salmonella enterica subsp. enterica serovar Fanti tRNA-Cys
  3421. Salmonella enterica subsp. enterica serovar Farmsen tRNA-Cys
  3422. Salmonella enterica subsp. enterica serovar Florida tRNA-Cys
  3423. Salmonella enterica subsp. enterica serovar Flottbek tRNA-Cys
  3424. Salmonella enterica subsp. enterica serovar Fluntern tRNA-Cys
  3425. Salmonella enterica subsp. enterica serovar Freetown tRNA-Cys
  3426. Salmonella enterica subsp. enterica serovar Fresno str. ST224 tRNA-Cys
  3427. Salmonella enterica subsp. enterica serovar Fresno tRNA-Cys
  3428. Salmonella enterica subsp. enterica serovar Frintrop tRNA-Cys
  3429. Salmonella enterica subsp. enterica serovar Fufu tRNA-Cys
  3430. Salmonella enterica subsp. enterica serovar Fulica tRNA-Cys
  3431. Salmonella enterica subsp. enterica serovar Gafsa tRNA-Cys
  3432. Salmonella enterica subsp. enterica serovar Galiema tRNA-Cys
  3433. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. CDC1983-67 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3434. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. FCAV198 tRNA-Cys
  3435. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum str. RKS5078 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3436. Salmonella enterica subsp. enterica serovar Gallinarum/Pullorum tRNA-Cys
  3437. Salmonella enterica subsp. enterica serovar Gallinarum str. 287/91 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3438. Salmonella enterica subsp. enterica serovar Gallinarum str. 9184 tRNA-Cys
  3439. Salmonella enterica subsp. enterica serovar Gallinarum str. CFSAN000571 tRNA-Cys
  3440. Salmonella enterica subsp. enterica serovar Gallinarum str. SG9 tRNA-Cys
  3441. Salmonella enterica subsp. enterica serovar Gallinarum tRNA-Cys(gca)
  3442. Salmonella enterica subsp. enterica serovar Gambia tRNA-Cys
  3443. Salmonella enterica subsp. enterica serovar Gaminara str. A4-567 tRNA-Cys
  3444. Salmonella enterica subsp. enterica serovar Gaminara str. ATCC BAA-711 tRNA-Cys
  3445. Salmonella enterica subsp. enterica serovar Gaminara str. SA20063285 tRNA-Cys
  3446. Salmonella enterica subsp. enterica serovar Gaminara tRNA-Cys
  3447. Salmonella enterica subsp. enterica serovar Garoli tRNA-Cys
  3448. Salmonella enterica subsp. enterica serovar Gatineau tRNA-Cys
  3449. Salmonella enterica subsp. enterica serovar Gatow tRNA-Cys
  3450. Salmonella enterica subsp. enterica serovar Gatuni tRNA-Cys
  3451. Salmonella enterica subsp. enterica serovar Gdansk tRNA-Cys
  3452. Salmonella enterica subsp. enterica serovar Georgia tRNA-Cys
  3453. Salmonella enterica subsp. enterica serovar Geraldton tRNA-Cys
  3454. Salmonella enterica subsp. enterica serovar Giessen tRNA-Cys
  3455. Salmonella enterica subsp. enterica serovar Give str. 564 tRNA-Cys
  3456. Salmonella enterica subsp. enterica serovar Give str. S5-487 tRNA-Cys
  3457. Salmonella enterica subsp. enterica serovar Give tRNA-Cys(gca)
  3458. Salmonella enterica subsp. enterica serovar Give var. 15 str. CFSAN004343 tRNA-Cys
  3459. Salmonella enterica subsp. enterica serovar Glostrup tRNA-Cys
  3460. Salmonella enterica subsp. enterica serovar Gloucester tRNA-Cys
  3461. Salmonella enterica subsp. enterica serovar Godesberg tRNA-Cys
  3462. Salmonella enterica subsp. enterica serovar Gokul tRNA-Cys
  3463. Salmonella enterica subsp. enterica serovar Goldcoast tRNA-Cys(gca)
  3464. Salmonella enterica subsp. enterica serovar Gombe tRNA-Cys
  3465. Salmonella enterica subsp. enterica serovar Goverdhan tRNA-Cys
  3466. Salmonella enterica subsp. enterica serovar Grumpensis tRNA-Cys
  3467. Salmonella enterica subsp. enterica serovar Gueuletapee tRNA-Cys
  3468. Salmonella enterica subsp. enterica serovar Guildford tRNA-Cys
  3469. Salmonella enterica subsp. enterica serovar Guinea tRNA-Cys
  3470. Salmonella enterica subsp. enterica serovar Haardt tRNA-Cys
  3471. Salmonella enterica subsp. enterica serovar Hadar str. ATCC 51956 tRNA-Cys
  3472. Salmonella enterica subsp. enterica serovar Hadar str. RI_05P066 tRNA-Cys
  3473. Salmonella enterica subsp. enterica serovar Hadar str. SA20026260 tRNA-Cys
  3474. Salmonella enterica subsp. enterica serovar Hadar tRNA-Cys
  3475. Salmonella enterica subsp. enterica serovar Haduna tRNA-Cys
  3476. Salmonella enterica subsp. enterica serovar Haga tRNA-Cys
  3477. Salmonella enterica subsp. enterica serovar Haifa tRNA-Cys
  3478. Salmonella enterica subsp. enterica serovar Halle tRNA-Cys
  3479. Salmonella enterica subsp. enterica serovar Hartford str. CFSAN001075 tRNA-Cys
  3480. Salmonella enterica subsp. enterica serovar Hartford tRNA-Cys(gca)
  3481. Salmonella enterica subsp. enterica serovar Hato tRNA-Cys
  3482. Salmonella enterica subsp. enterica serovar Havana str. CFSAN001082 tRNA-Cys
  3483. Salmonella enterica subsp. enterica serovar Havana tRNA-Cys(gca)
  3484. Salmonella enterica subsp. enterica serovar Hayindogo tRNA-Cys
  3485. Salmonella enterica subsp. enterica serovar Heidelberg str. 21381 tRNA-Cys
  3486. Salmonella enterica subsp. enterica serovar Heidelberg str. 24390 tRNA-Cys
  3487. Salmonella enterica subsp. enterica serovar Heidelberg str. 24393 tRNA-Cys
  3488. Salmonella enterica subsp. enterica serovar Heidelberg str. 29169 tRNA-Cys
  3489. Salmonella enterica subsp. enterica serovar Heidelberg str. 32507 tRNA-Cys
  3490. Salmonella enterica subsp. enterica serovar Heidelberg str. 41563 tRNA-Cys
  3491. Salmonella enterica subsp. enterica serovar Heidelberg str. 41565 tRNA-Cys
  3492. Salmonella enterica subsp. enterica serovar Heidelberg str. 41566 tRNA-Cys
  3493. Salmonella enterica subsp. enterica serovar Heidelberg str. 41567 tRNA-Cys
  3494. Salmonella enterica subsp. enterica serovar Heidelberg str. 41573 tRNA-Cys
  3495. Salmonella enterica subsp. enterica serovar Heidelberg str. 41576 tRNA-Cys
  3496. Salmonella enterica subsp. enterica serovar Heidelberg str. 41578 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3497. Salmonella enterica subsp. enterica serovar Heidelberg str. 41579 tRNA-Cys
  3498. Salmonella enterica subsp. enterica serovar Heidelberg str. 41584 tRNA-Cys
  3499. Salmonella enterica subsp. enterica serovar Heidelberg str. 579082-8 tRNA-Cys
  3500. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-10 tRNA-Cys
  3501. Salmonella enterica subsp. enterica serovar Heidelberg str. 579083-19 tRNA-Cys
  3502. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-34 tRNA-Cys
  3503. Salmonella enterica subsp. enterica serovar Heidelberg str. 607309-5 tRNA-Cys
  3504. Salmonella enterica subsp. enterica serovar Heidelberg str. 607310-1 tRNA-Cys
  3505. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-11 tRNA-Cys
  3506. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-12 tRNA-Cys
  3507. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-14 tRNA-Cys
  3508. Salmonella enterica subsp. enterica serovar Heidelberg str. 622737-21 tRNA-Cys
  3509. Salmonella enterica subsp. enterica serovar Heidelberg str. 632675-24 tRNA-Cys
  3510. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-15 tRNA-Cys
  3511. Salmonella enterica subsp. enterica serovar Heidelberg str. 638982-21 tRNA-Cys
  3512. Salmonella enterica subsp. enterica serovar Heidelberg str. 640151-11 tRNA-Cys
  3513. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-3 tRNA-Cys
  3514. Salmonella enterica subsp. enterica serovar Heidelberg str. 670102-5 tRNA-Cys
  3515. Salmonella enterica subsp. enterica serovar Heidelberg str. 75-3547 tRNA-Cys
  3516. Salmonella enterica subsp. enterica serovar Heidelberg str. 76-0300 tRNA-Cys
  3517. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-1831 tRNA-Cys
  3518. Salmonella enterica subsp. enterica serovar Heidelberg str. 77-2823 tRNA-Cys
  3519. Salmonella enterica subsp. enterica serovar Heidelberg str. 79-0480 tRNA-Cys
  3520. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-1617 tRNA-Cys
  3521. Salmonella enterica subsp. enterica serovar Heidelberg str. 82-2052 tRNA-Cys
  3522. Salmonella enterica subsp. enterica serovar Heidelberg str. 83-1068 tRNA-Cys
  3523. Salmonella enterica subsp. enterica serovar Heidelberg str. 84-1004 tRNA-Cys
  3524. Salmonella enterica subsp. enterica serovar Heidelberg str. 85-0486 tRNA-Cys
  3525. Salmonella enterica subsp. enterica serovar Heidelberg str. 86-0255 tRNA-Cys
  3526. Salmonella enterica subsp. enterica serovar Heidelberg str. 87-0208 tRNA-Cys
  3527. Salmonella enterica subsp. enterica serovar Heidelberg str. 88-0312 tRNA-Cys
  3528. Salmonella enterica subsp. enterica serovar Heidelberg str. 89-0213 tRNA-Cys
  3529. Salmonella enterica subsp. enterica serovar Heidelberg str. 90-0318 tRNA-Cys
  3530. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0138 tRNA-Cys
  3531. Salmonella enterica subsp. enterica serovar Heidelberg str. 92-0144 tRNA-Cys
  3532. Salmonella enterica subsp. enterica serovar Heidelberg str. B182 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3533. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000577 tRNA-Cys
  3534. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN000578 tRNA-Cys
  3535. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001902 tRNA-Cys
  3536. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN001914 tRNA-Cys
  3537. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002056 tRNA-Cys
  3538. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002057 tRNA-Cys
  3539. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002058 tRNA-Cys
  3540. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002059 tRNA-Cys
  3541. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002060 tRNA-Cys
  3542. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002061 tRNA-Cys
  3543. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002062 tRNA-Cys
  3544. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002063 tRNA-Cys
  3545. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3546. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002065 tRNA-Cys
  3547. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002066 tRNA-Cys
  3548. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002067 tRNA-Cys
  3549. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002068 tRNA-Cys
  3550. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002069 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3551. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002071 tRNA-Cys
  3552. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002072 tRNA-Cys
  3553. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002073 tRNA-Cys
  3554. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002074 tRNA-Cys
  3555. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002075 tRNA-Cys
  3556. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00322 tRNA-Cys
  3557. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00323 tRNA-Cys
  3558. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00324 tRNA-Cys
  3559. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00325 tRNA-Cys
  3560. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00326 tRNA-Cys
  3561. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00327 tRNA-Cys
  3562. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN00328 tRNA-Cys
  3563. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003462 tRNA-Cys
  3564. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003463 tRNA-Cys
  3565. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003465 tRNA-Cys
  3566. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003467 tRNA-Cys
  3567. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003468 tRNA-Cys
  3568. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003469 tRNA-Cys
  3569. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003472 tRNA-Cys
  3570. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003475 tRNA-Cys
  3571. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003480 tRNA-Cys
  3572. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003482 tRNA-Cys
  3573. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003484 tRNA-Cys
  3574. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003485 tRNA-Cys
  3575. Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN003487 tRNA-Cys
  3576. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM20752 tRNA-Cys
  3577. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24359 tRNA-Cys
  3578. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24388 tRNA-Cys
  3579. Salmonella enterica subsp. enterica serovar Heidelberg str. CVM24391 tRNA-Cys
  3580. Salmonella enterica subsp. enterica serovar Heidelberg str. N1514 tRNA-Cys
  3581. Salmonella enterica subsp. enterica serovar Heidelberg str. N1536 tRNA-Cys
  3582. Salmonella enterica subsp. enterica serovar Heidelberg str. N15757 tRNA-Cys
  3583. Salmonella enterica subsp. enterica serovar Heidelberg str. N18393 tRNA-Cys
  3584. Salmonella enterica subsp. enterica serovar Heidelberg str. N18413 tRNA-Cys
  3585. Salmonella enterica subsp. enterica serovar Heidelberg str. N18440 tRNA-Cys
  3586. Salmonella enterica subsp. enterica serovar Heidelberg str. N18453 tRNA-Cys
  3587. Salmonella enterica subsp. enterica serovar Heidelberg str. N189 tRNA-Cys
  3588. Salmonella enterica subsp. enterica serovar Heidelberg str. N19871 tRNA-Cys
  3589. Salmonella enterica subsp. enterica serovar Heidelberg str. N19992 tRNA-Cys
  3590. Salmonella enterica subsp. enterica serovar Heidelberg str. N20134 tRNA-Cys
  3591. Salmonella enterica subsp. enterica serovar Heidelberg str. N26457 tRNA-Cys
  3592. Salmonella enterica subsp. enterica serovar Heidelberg str. N29341 tRNA-Cys
  3593. Salmonella enterica subsp. enterica serovar Heidelberg str. N30678 tRNA-Cys
  3594. Salmonella enterica subsp. enterica serovar Heidelberg str. N418 tRNA-Cys
  3595. Salmonella enterica subsp. enterica serovar Heidelberg str. N4403 tRNA-Cys
  3596. Salmonella enterica subsp. enterica serovar Heidelberg str. N4496 tRNA-Cys
  3597. Salmonella enterica subsp. enterica serovar Heidelberg str. N4541 tRNA-Cys
  3598. Salmonella enterica subsp. enterica serovar Heidelberg str. N4630 tRNA-Cys
  3599. Salmonella enterica subsp. enterica serovar Heidelberg str. N653 tRNA-Cys
  3600. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013193 tRNA-Cys
  3601. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013312 tRNA-Cys
  3602. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013343 tRNA-Cys
  3603. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013374 tRNA-Cys
  3604. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-013988 tRNA-Cys
  3605. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014316 tRNA-Cys
  3606. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014319 tRNA-Cys
  3607. Salmonella enterica subsp. enterica serovar Heidelberg str. RI-11-014588 tRNA-Cys
  3608. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA31 tRNA-Cys
  3609. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA32 tRNA-Cys
  3610. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA33 tRNA-Cys
  3611. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 tRNA-Cys
  3612. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA36 tRNA-Cys
  3613. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA37 tRNA-Cys
  3614. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA 39 tRNA-Cys
  3615. Salmonella enterica subsp. enterica serovar Heidelberg str. SARA40 tRNA-Cys
  3616. Salmonella enterica subsp. enterica serovar Heidelberg str. SL476 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3617. Salmonella enterica subsp. enterica serovar Heidelberg tRNA-Cys(gca)
  3618. Salmonella enterica subsp. enterica serovar Herston tRNA-Cys
  3619. Salmonella enterica subsp. enterica serovar Hessarek tRNA-Cys
  3620. Salmonella enterica subsp. enterica serovar Hillingdon str. N1529-D3 tRNA-Cys
  3621. Salmonella enterica subsp. enterica serovar Hillingdon tRNA-Cys
  3622. Salmonella enterica subsp. enterica serovar Hindmarsh tRNA-Cys
  3623. Salmonella enterica subsp. enterica serovar Hissar tRNA-Cys
  3624. Salmonella enterica subsp. enterica serovar Holcomb tRNA-Cys
  3625. Salmonella enterica subsp. enterica serovar Horsham tRNA-Cys
  3626. Salmonella enterica subsp. enterica serovar Houston tRNA-Cys
  3627. Salmonella enterica subsp. enterica serovar Hull tRNA-Cys
  3628. Salmonella enterica subsp. enterica serovar Hvittingfoss str. A4-620 tRNA-Cys
  3629. Salmonella enterica subsp. enterica serovar Hvittingfoss str. SA20014981 tRNA-Cys
  3630. Salmonella enterica subsp. enterica serovar Hvittingfoss tRNA-Cys
  3631. Salmonella enterica subsp. enterica serovar Ibadan tRNA-Cys
  3632. Salmonella enterica subsp. enterica serovar Idikan tRNA-Cys
  3633. Salmonella enterica subsp. enterica serovar Ilala tRNA-Cys
  3634. Salmonella enterica subsp. enterica serovar Indiana str. ATCC 51959 tRNA-Cys
  3635. Salmonella enterica subsp. enterica serovar Indiana tRNA-Cys
  3636. Salmonella enterica subsp. enterica serovar India str. SA20085604 tRNA-Cys
  3637. Salmonella enterica subsp. enterica serovar India tRNA-Cys
  3638. Salmonella enterica subsp. enterica serovar Infantis str. 119944 tRNA-Cys
  3639. Salmonella enterica subsp. enterica serovar Infantis str. 335-3 tRNA-Cys
  3640. Salmonella enterica subsp. enterica serovar Infantis str. CFSAN000522 tRNA-Cys
  3641. Salmonella enterica subsp. enterica serovar Infantis str. CVM 17958 tRNA-Cys
  3642. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22577 tRNA-Cys
  3643. Salmonella enterica subsp. enterica serovar Infantis str. CVM 22582 tRNA-Cys
  3644. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23697 tRNA-Cys
  3645. Salmonella enterica subsp. enterica serovar Infantis str. CVM 23729 tRNA-Cys
  3646. Salmonella enterica subsp. enterica serovar Infantis str. CVM 818 tRNA-Cys
  3647. Salmonella enterica subsp. enterica serovar Infantis str. CVM N13139 tRNA-Cys
  3648. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15228 tRNA-Cys
  3649. Salmonella enterica subsp. enterica serovar Infantis str. CVM N15773 tRNA-Cys
  3650. Salmonella enterica subsp. enterica serovar Infantis str. CVM N19983 tRNA-Cys
  3651. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20078 tRNA-Cys
  3652. Salmonella enterica subsp. enterica serovar Infantis str. CVM N20272 tRNA-Cys
  3653. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23532 tRNA-Cys
  3654. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23771 tRNA-Cys
  3655. Salmonella enterica subsp. enterica serovar Infantis str. CVM N23791 tRNA-Cys
  3656. Salmonella enterica subsp. enterica serovar Infantis str. CVM N26093 tRNA-Cys
  3657. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29304 tRNA-Cys
  3658. Salmonella enterica subsp. enterica serovar Infantis str. CVM N29379 tRNA-Cys
  3659. Salmonella enterica subsp. enterica serovar Infantis str. CVM N31594 tRNA-Cys
  3660. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32590PS tRNA-Cys
  3661. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32597PS tRNA-Cys
  3662. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32599PS tRNA-Cys
  3663. Salmonella enterica subsp. enterica serovar Infantis str. CVM N32760 tRNA-Cys
  3664. Salmonella enterica subsp. enterica serovar Infantis str. CVM N34868PS tRNA-Cys
  3665. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35495PS tRNA-Cys
  3666. Salmonella enterica subsp. enterica serovar Infantis str. CVM N35518 tRNA-Cys
  3667. Salmonella enterica subsp. enterica serovar Infantis str. CVM N38848 tRNA-Cys
  3668. Salmonella enterica subsp. enterica serovar Infantis str. CVM N41903 tRNA-Cys
  3669. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42236 tRNA-Cys
  3670. Salmonella enterica subsp. enterica serovar Infantis str. CVM N42459 tRNA-Cys
  3671. Salmonella enterica subsp. enterica serovar Infantis str. SARB27 tRNA-Cys
  3672. Salmonella enterica subsp. enterica serovar Infantis tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3673. Salmonella enterica subsp. enterica serovar Inganda tRNA-Cys
  3674. Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 tRNA-Cys
  3675. Salmonella enterica subsp. enterica serovar Inverness str. R8-3668 tRNA-Cys
  3676. Salmonella enterica subsp. enterica serovar Inverness tRNA-Cys
  3677. Salmonella enterica subsp. enterica serovar Irumu tRNA-Cys
  3678. Salmonella enterica subsp. enterica serovar Isangi tRNA-Cys
  3679. Salmonella enterica subsp. enterica serovar Istanbul tRNA-Cys
  3680. Salmonella enterica subsp. enterica serovar Itami str. SA20014991 tRNA-Cys
  3681. Salmonella enterica subsp. enterica serovar Itami tRNA-Cys
  3682. Salmonella enterica subsp. enterica serovar Ituri tRNA-Cys
  3683. Salmonella enterica subsp. enterica serovar Jangwani tRNA-Cys
  3684. Salmonella enterica subsp. enterica serovar Java tRNA-Cys(gca)
  3685. Salmonella enterica subsp. enterica serovar Javiana str. 10721 tRNA-Cys
  3686. Salmonella enterica subsp. enterica serovar Javiana str. ATCC BAA-1593 tRNA-Cys
  3687. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000904 tRNA-Cys
  3688. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN000905 tRNA-Cys
  3689. Salmonella enterica subsp. enterica serovar Javiana str. CFSAN001992 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3690. Salmonella enterica subsp. enterica serovar Javiana str. GA_MM04042433 tRNA-Cys
  3691. Salmonella enterica subsp. enterica serovar Javiana str. PRS_2010_0720 tRNA-Cys
  3692. Salmonella enterica subsp. enterica serovar Javiana tRNA-Cys
  3693. Salmonella enterica subsp. enterica serovar Jedburgh tRNA-Cys
  3694. Salmonella enterica subsp. enterica serovar Jerusalem tRNA-Cys
  3695. Salmonella enterica subsp. enterica serovar Joal tRNA-Cys
  3696. Salmonella enterica subsp. enterica serovar Jodhpur tRNA-Cys
  3697. Salmonella enterica subsp. enterica serovar Johannesburg str. S5-703 tRNA-Cys
  3698. Salmonella enterica subsp. enterica serovar Johannesburg str. SA20025782 tRNA-Cys
  3699. Salmonella enterica subsp. enterica serovar Johannesburg str. ST203 tRNA-Cys
  3700. Salmonella enterica subsp. enterica serovar Johannesburg subsp. enterica serovar Johannesburg tRNA-Cys
  3701. Salmonella enterica subsp. enterica serovar Jubilee tRNA-Cys
  3702. Salmonella enterica subsp. enterica serovar Jukestown tRNA-Cys
  3703. Salmonella enterica subsp. enterica serovar Kaapstad tRNA-Cys
  3704. Salmonella enterica subsp. enterica serovar Kalamu tRNA-Cys
  3705. Salmonella enterica subsp. enterica serovar Kallo tRNA-Cys
  3706. Salmonella enterica subsp. enterica serovar Kambole tRNA-Cys
  3707. Salmonella enterica subsp. enterica serovar Kande tRNA-Cys
  3708. Salmonella enterica subsp. enterica serovar Kandla tRNA-Cys
  3709. Salmonella enterica subsp. enterica serovar Kaolack tRNA-Cys
  3710. Salmonella enterica subsp. enterica serovar Kapemba tRNA-Cys
  3711. Salmonella enterica subsp. enterica serovar Karamoja tRNA-Cys
  3712. Salmonella enterica subsp. enterica serovar Kasenyi tRNA-Cys
  3713. Salmonella enterica subsp. enterica serovar Kastrup tRNA-Cys
  3714. Salmonella enterica subsp. enterica serovar Kedougou tRNA-Cys
  3715. Salmonella enterica subsp. enterica serovar Kentucky str. 0253 tRNA-Cys
  3716. Salmonella enterica subsp. enterica serovar Kentucky str. 13562 tRNA-Cys
  3717. Salmonella enterica subsp. enterica serovar Kentucky str. 20793 tRNA-Cys
  3718. Salmonella enterica subsp. enterica serovar Kentucky str. 22694 tRNA-Cys
  3719. Salmonella enterica subsp. enterica serovar Kentucky str. 29166 tRNA-Cys
  3720. Salmonella enterica subsp. enterica serovar Kentucky str. 29439 tRNA-Cys
  3721. Salmonella enterica subsp. enterica serovar Kentucky str. 5349 tRNA-Cys
  3722. Salmonella enterica subsp. enterica serovar Kentucky str. ATCC 9263 tRNA-Cys
  3723. Salmonella enterica subsp. enterica serovar Kentucky str. CVM29188 tRNA-Cys
  3724. Salmonella enterica subsp. enterica serovar Kentucky str. N312 tRNA-Cys
  3725. Salmonella enterica subsp. enterica serovar Kentucky str. SA20030505 tRNA-Cys
  3726. Salmonella enterica subsp. enterica serovar Kentucky subsp. enterica serovar Kentucky tRNA-Cys
  3727. Salmonella enterica subsp. enterica serovar Kenya tRNA-Cys
  3728. Salmonella enterica subsp. enterica serovar Kiambu tRNA-Cys
  3729. Salmonella enterica subsp. enterica serovar Kibi tRNA-Cys
  3730. Salmonella enterica subsp. enterica serovar Kibusi tRNA-Cys
  3731. Salmonella enterica subsp. enterica serovar Kimberley tRNA-Cys
  3732. Salmonella enterica subsp. enterica serovar Kimuenza tRNA-Cys
  3733. Salmonella enterica subsp. enterica serovar Kingabwa tRNA-Cys
  3734. Salmonella enterica subsp. enterica serovar Kingston tRNA-Cys
  3735. Salmonella enterica subsp. enterica serovar Kinondoni tRNA-Cys
  3736. Salmonella enterica subsp. enterica serovar Kinshasa tRNA-Cys
  3737. Salmonella enterica subsp. enterica serovar Kintambo tRNA-Cys
  3738. Salmonella enterica subsp. enterica serovar Kirkee tRNA-Cys
  3739. Salmonella enterica subsp. enterica serovar Kisangani tRNA-Cys
  3740. Salmonella enterica subsp. enterica serovar Kisarawe tRNA-Cys
  3741. Salmonella enterica subsp. enterica serovar Kisii tRNA-Cys
  3742. Salmonella enterica subsp. enterica serovar Kivu tRNA-Cys
  3743. Salmonella enterica subsp. enterica serovar Koessen str. S-1501 tRNA-Cys
  3744. Salmonella enterica subsp. enterica serovar Koketime tRNA-Cys
  3745. Salmonella enterica subsp. enterica serovar Kokomlemle tRNA-Cys
  3746. Salmonella enterica subsp. enterica serovar Korlebu tRNA-Cys
  3747. Salmonella enterica subsp. enterica serovar Kottbus tRNA-Cys
  3748. Salmonella enterica subsp. enterica serovar Kouka tRNA-Cys
  3749. Salmonella enterica subsp. enterica serovar Krefeld str. SA20030536 tRNA-Cys
  3750. Salmonella enterica subsp. enterica serovar Krefeld tRNA-Cys
  3751. Salmonella enterica subsp. enterica serovar Kua tRNA-Cys
  3752. Salmonella enterica subsp. enterica serovar Kuessel tRNA-Cys
  3753. Salmonella enterica subsp. enterica serovar Kumasi tRNA-Cys
  3754. Salmonella enterica subsp. enterica serovar Kunzendorf tRNA-Cys
  3755. Salmonella enterica subsp. enterica serovar Lagos tRNA-Cys
  3756. Salmonella enterica subsp. enterica serovar Lanka tRNA-Cys
  3757. Salmonella enterica subsp. enterica serovar Lansing tRNA-Cys
  3758. Salmonella enterica subsp. enterica serovar Larochelle tRNA-Cys
  3759. Salmonella enterica subsp. enterica serovar Lattenkamp tRNA-Cys
  3760. Salmonella enterica subsp. enterica serovar Lawndale tRNA-Cys
  3761. Salmonella enterica subsp. enterica serovar Leatherhead tRNA-Cys
  3762. Salmonella enterica subsp. enterica serovar Leeuwarden tRNA-Cys
  3763. Salmonella enterica subsp. enterica serovar Legon tRNA-Cys
  3764. Salmonella enterica subsp. enterica serovar Leoben tRNA-Cys
  3765. Salmonella enterica subsp. enterica serovar Lerum tRNA-Cys
  3766. Salmonella enterica subsp. enterica serovar Lexington tRNA-Cys
  3767. Salmonella enterica subsp. enterica serovar Lexington var. 15+ tRNA-Cys
  3768. Salmonella enterica subsp. enterica serovar Lika tRNA-Cys
  3769. Salmonella enterica subsp. enterica serovar Lille tRNA-Cys
  3770. Salmonella enterica subsp. enterica serovar Limete tRNA-Cys
  3771. Salmonella enterica subsp. enterica serovar Lindern tRNA-Cys
  3772. Salmonella enterica subsp. enterica serovar Lingwala tRNA-Cys
  3773. Salmonella enterica subsp. enterica serovar Linton tRNA-Cys
  3774. Salmonella enterica subsp. enterica serovar Litchfield str. CFSAN001076 tRNA-Cys
  3775. Salmonella enterica subsp. enterica serovar Litchfield tRNA-Cys
  3776. Salmonella enterica subsp. enterica serovar Liverpool tRNA-Cys
  3777. Salmonella enterica subsp. enterica serovar Livingstone tRNA-Cys
  3778. Salmonella enterica subsp. enterica serovar Llandoff tRNA-Cys
  3779. Salmonella enterica subsp. enterica serovar Loanda tRNA-Cys
  3780. Salmonella enterica subsp. enterica serovar Lomalinda tRNA-Cys
  3781. Salmonella enterica subsp. enterica serovar Lome tRNA-Cys
  3782. Salmonella enterica subsp. enterica serovar London str. CFSAN001081 tRNA-Cys
  3783. Salmonella enterica subsp. enterica serovar London tRNA-Cys
  3784. Salmonella enterica subsp. enterica serovar Louisiana tRNA-Cys
  3785. Salmonella enterica subsp. enterica serovar Lubbock tRNA-Cys
  3786. Salmonella enterica subsp. enterica serovar Luciana tRNA-Cys
  3787. Salmonella enterica subsp. enterica serovar Luke tRNA-Cys
  3788. Salmonella enterica subsp. enterica serovar Macclesfield str. S-1643 tRNA-Cys
  3789. Salmonella enterica subsp. enterica serovar Madelia tRNA-Cys(gca)
  3790. Salmonella enterica subsp. enterica serovar Malaysia tRNA-Cys
  3791. Salmonella enterica subsp. enterica serovar Malstatt tRNA-Cys
  3792. Salmonella enterica subsp. enterica serovar Manchester str. ST278 tRNA-Cys
  3793. Salmonella enterica subsp. enterica serovar Manchester tRNA-Cys
  3794. Salmonella enterica subsp. enterica serovar Manhattan str. 111113 tRNA-Cys-GCA
  3795. Salmonella enterica subsp. enterica serovar Manhattan str. CFSAN001078 tRNA-Cys
  3796. Salmonella enterica subsp. enterica serovar Manhattan str. SA20034532 tRNA-Cys
  3797. Salmonella enterica subsp. enterica serovar Manhattan tRNA-Cys
  3798. Salmonella enterica subsp. enterica serovar Mapo tRNA-Cys
  3799. Salmonella enterica subsp. enterica serovar Maracaibo tRNA-Cys
  3800. Salmonella enterica subsp. enterica serovar Matadi tRNA-Cys
  3801. Salmonella enterica subsp. enterica serovar Matopeni tRNA-Cys
  3802. Salmonella enterica subsp. enterica serovar Mbandaka str. ATCC 51958 tRNA-Cys
  3803. Salmonella enterica subsp. enterica serovar Mbandaka tRNA-Cys
  3804. Salmonella enterica subsp. enterica serovar Meleagridis str. 0047 tRNA-Cys
  3805. Salmonella enterica subsp. enterica serovar Meleagridis tRNA-Cys
  3806. Salmonella enterica subsp. enterica serovar Memphis tRNA-Cys
  3807. Salmonella enterica subsp. enterica serovar Mendoza tRNA-Cys
  3808. Salmonella enterica subsp. enterica serovar Menston tRNA-Cys
  3809. Salmonella enterica subsp. enterica serovar Mesbit tRNA-Cys
  3810. Salmonella enterica subsp. enterica serovar Mgulani tRNA-Cys
  3811. Salmonella enterica subsp. enterica serovar Miami str. 1923 tRNA-Cys
  3812. Salmonella enterica subsp. enterica serovar Miami str. CFSAN000579 tRNA-Cys
  3813. Salmonella enterica subsp. enterica serovar Miami tRNA-Cys
  3814. Salmonella enterica subsp. enterica serovar Michigan tRNA-Cys
  3815. Salmonella enterica subsp. enterica serovar Middlesbrough tRNA-Cys
  3816. Salmonella enterica subsp. enterica serovar Midway tRNA-Cys
  3817. Salmonella enterica subsp. enterica serovar Mikawasima tRNA-Cys
  3818. Salmonella enterica subsp. enterica serovar Millesi tRNA-Cys
  3819. Salmonella enterica subsp. enterica serovar Milwaukee str. SA19950795 tRNA-Cys
  3820. Salmonella enterica subsp. enterica serovar Minneapolis tRNA-Cys
  3821. Salmonella enterica subsp. enterica serovar Minnesota str. A4-603 tRNA-Cys
  3822. Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 tRNA-Cys
  3823. Salmonella enterica subsp. enterica serovar Minnesota tRNA-Cys
  3824. Salmonella enterica subsp. enterica serovar Mishmarhaemek tRNA-Cys
  3825. Salmonella enterica subsp. enterica serovar Mississippi str. A4-633 tRNA-Cys
  3826. Salmonella enterica subsp. enterica serovar Mississippi tRNA-Cys
  3827. Salmonella enterica subsp. enterica serovar Moero tRNA-Cys
  3828. Salmonella enterica subsp. enterica serovar Mokola tRNA-Cys
  3829. Salmonella enterica subsp. enterica serovar Molade tRNA-Cys
  3830. Salmonella enterica subsp. enterica serovar Monophasic tRNA-Cys
  3831. Salmonella enterica subsp. enterica serovar Monschaui tRNA-Cys
  3832. Salmonella enterica subsp. enterica serovar Montevideo str. 0263 tRNA-Cys
  3833. Salmonella enterica subsp. enterica serovar Montevideo str. 0269 tRNA-Cys
  3834. Salmonella enterica subsp. enterica serovar Montevideo str. 19N tRNA-Cys
  3835. Salmonella enterica subsp. enterica serovar Montevideo str. 2009083312 tRNA-Cys
  3836. Salmonella enterica subsp. enterica serovar Montevideo str. 2009085258 tRNA-Cys
  3837. Salmonella enterica subsp. enterica serovar Montevideo str. 29N tRNA-Cys
  3838. Salmonella enterica subsp. enterica serovar Montevideo str. 315731156 tRNA-Cys
  3839. Salmonella enterica subsp. enterica serovar Montevideo str. 315996572 tRNA-Cys
  3840. Salmonella enterica subsp. enterica serovar Montevideo str. 316111868 tRNA-Cys
  3841. Salmonella enterica subsp. enterica serovar Montevideo str. 366867 tRNA-Cys
  3842. Salmonella enterica subsp. enterica serovar Montevideo str. 413180 tRNA-Cys
  3843. Salmonella enterica subsp. enterica serovar Montevideo str. 414877 tRNA-Cys
  3844. Salmonella enterica subsp. enterica serovar Montevideo str. 42N tRNA-Cys
  3845. Salmonella enterica subsp. enterica serovar Montevideo str. 4441 H tRNA-Cys
  3846. Salmonella enterica subsp. enterica serovar Montevideo str. 446600 tRNA-Cys
  3847. Salmonella enterica subsp. enterica serovar Montevideo str. 468879-1 tRNA-Cys
  3848. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-1 tRNA-Cys
  3849. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-3 tRNA-Cys
  3850. Salmonella enterica subsp. enterica serovar Montevideo str. 495297-4 tRNA-Cys
  3851. Salmonella enterica subsp. enterica serovar Montevideo str. 507440-20 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3852. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-1 tRNA-Cys
  3853. Salmonella enterica subsp. enterica serovar Montevideo str. 515920-2 tRNA-Cys
  3854. Salmonella enterica subsp. enterica serovar Montevideo str. 531954 tRNA-Cys
  3855. Salmonella enterica subsp. enterica serovar Montevideo str. 556150-1 tRNA-Cys
  3856. Salmonella enterica subsp. enterica serovar Montevideo str. 556152 tRNA-Cys
  3857. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-1 tRNA-Cys
  3858. Salmonella enterica subsp. enterica serovar Montevideo str. 609458-2 tRNA-Cys
  3859. Salmonella enterica subsp. enterica serovar Montevideo str. 609460 tRNA-Cys
  3860. Salmonella enterica subsp. enterica serovar Montevideo str. 644129 tRNA-Cys
  3861. Salmonella enterica subsp. enterica serovar Montevideo str. 80959-06 tRNA-Cys
  3862. Salmonella enterica subsp. enterica serovar Montevideo str. 81038-01 tRNA-Cys
  3863. Salmonella enterica subsp. enterica serovar Montevideo str. 8387 tRNA-Cys
  3864. Salmonella enterica subsp. enterica serovar Montevideo str. ATCC BAA710 tRNA-Cys
  3865. Salmonella enterica subsp. enterica serovar Montevideo str. CASC_09SCPH15965 tRNA-Cys
  3866. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 07-0954 tRNA-Cys
  3867. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 08-1942 tRNA-Cys
  3868. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2009K-0792 tRNA-Cys
  3869. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2010K-0257 tRNA-Cys
  3870. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2011K-1674 tRNA-Cys
  3871. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2012K-1544 tRNA-Cys
  3872. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 2013K-0218 tRNA-Cys
  3873. Salmonella enterica subsp. enterica serovar Montevideo str. CDC 86-0391 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3874. Salmonella enterica subsp. enterica serovar Montevideo str. CFSAN004346 tRNA-Cys
  3875. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035278 tRNA-Cys
  3876. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035318 tRNA-Cys
  3877. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035320 tRNA-Cys
  3878. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035321 tRNA-Cys
  3879. Salmonella enterica subsp. enterica serovar Montevideo str. CT_02035327 tRNA-Cys
  3880. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-2868 tRNA-Cys
  3881. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4673 tRNA-Cys
  3882. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4843 tRNA-Cys
  3883. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4916 tRNA-Cys
  3884. Salmonella enterica subsp. enterica serovar Montevideo str. FSL_R8-4922 tRNA-Cys
  3885. Salmonella enterica subsp. enterica serovar Montevideo str. FVM_628064 tRNA-Cys
  3886. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2009159199 tRNA-Cys
  3887. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008282 tRNA-Cys
  3888. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008283 tRNA-Cys
  3889. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008284 tRNA-Cys
  3890. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008285 tRNA-Cys
  3891. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008286 tRNA-Cys
  3892. Salmonella enterica subsp. enterica serovar Montevideo str. IA_2010008287 tRNA-Cys
  3893. Salmonella enterica subsp. enterica serovar Montevideo str. LQC 10 tRNA-Cys
  3894. Salmonella enterica subsp. enterica serovar Montevideo str. MB101509-0077 tRNA-Cys
  3895. Salmonella enterica subsp. enterica serovar Montevideo str. MB102109-0047 tRNA-Cys
  3896. Salmonella enterica subsp. enterica serovar Montevideo str. MB110209-0055 tRNA-Cys
  3897. Salmonella enterica subsp. enterica serovar Montevideo str. MB111609-0052 tRNA-Cys
  3898. Salmonella enterica subsp. enterica serovar Montevideo str. MD_MDA09249507 tRNA-Cys
  3899. Salmonella enterica subsp. enterica serovar Montevideo str. N19965 tRNA-Cys
  3900. Salmonella enterica subsp. enterica serovar Montevideo str. NC_MB110209-0054 tRNA-Cys
  3901. Salmonella enterica subsp. enterica serovar Montevideo str. OH_2009072675 tRNA-Cys
  3902. Salmonella enterica subsp. enterica serovar Montevideo str. S5-403 tRNA-Cys
  3903. Salmonella enterica subsp. enterica serovar Montevideo str. SARB30 tRNA-Cys
  3904. Salmonella enterica subsp. enterica serovar Montevideo str. SARB31 tRNA-Cys
  3905. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1900 tRNA-Cys
  3906. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1901 tRNA-Cys
  3907. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3908. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1904 tRNA-Cys
  3909. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1912 tRNA-Cys
  3910. Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1913 tRNA-Cys
  3911. Salmonella enterica subsp. enterica serovar Montevideo tRNA-Cys(gca)
  3912. Salmonella enterica subsp. enterica serovar Morehead tRNA-Cys
  3913. Salmonella enterica subsp. enterica serovar Moroto tRNA-Cys
  3914. Salmonella enterica subsp. enterica serovar Moscow str. S-1843 tRNA-Cys
  3915. Salmonella enterica subsp. enterica serovar Moscow str. SA20061414 tRNA-Cys
  3916. Salmonella enterica subsp. enterica serovar Moscow tRNA-Cys
  3917. Salmonella enterica subsp. enterica serovar Mountpleasant tRNA-Cys
  3918. Salmonella enterica subsp. enterica serovar Muenchen str. ATCC 8388 tRNA-Cys
  3919. Salmonella enterica subsp. enterica serovar Muenchen str. baa1594 tRNA-Cys
  3920. Salmonella enterica subsp. enterica serovar Muenchen str. baa1674 tRNA-Cys
  3921. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000585 tRNA-Cys
  3922. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000591 tRNA-Cys
  3923. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000593 tRNA-Cys
  3924. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000595 tRNA-Cys
  3925. Salmonella enterica subsp. enterica serovar Muenchen str. CFSAN000596 tRNA-Cys
  3926. Salmonella enterica subsp. enterica serovar Muenchen str. RKS4129 tRNA-Cys
  3927. Salmonella enterica subsp. enterica serovar Muenchen tRNA-Cys
  3928. Salmonella enterica subsp. enterica serovar Muenster str. 0315 tRNA-Cys
  3929. Salmonella enterica subsp. enterica serovar Muenster str. 420 tRNA-Cys
  3930. Salmonella enterica subsp. enterica serovar Muenster str. 660 tRNA-Cys
  3931. Salmonella enterica subsp. enterica serovar Muenster str. CFSAN004344 tRNA-Cys
  3932. Salmonella enterica subsp. enterica serovar Muenster tRNA-Cys
  3933. Salmonella enterica subsp. enterica serovar Nagoya tRNA-Cys
  3934. Salmonella enterica subsp. enterica serovar Namur str. 05-2929 tRNA-Cys
  3935. Salmonella enterica subsp. enterica serovar Napoli tRNA-Cys
  3936. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001091 tRNA-Cys
  3937. Salmonella enterica subsp. enterica serovar Nchanga str. CFSAN001092 tRNA-Cys
  3938. Salmonella enterica subsp. enterica serovar Nchanga tRNA-Cys
  3939. Salmonella enterica subsp. enterica serovar Ndolo tRNA-Cys
  3940. Salmonella enterica subsp. enterica serovar Nessziona tRNA-Cys
  3941. Salmonella enterica subsp. enterica serovar Neukoelln tRNA-Cys
  3942. Salmonella enterica subsp. enterica serovar Neunkirchen tRNA-Cys
  3943. Salmonella enterica subsp. enterica serovar Newbrunswick tRNA-Cys
  3944. Salmonella enterica subsp. enterica serovar Newington tRNA-Cys
  3945. Salmonella enterica subsp. enterica serovar Newlands tRNA-Cys
  3946. Salmonella enterica subsp. enterica serovar Newmexico tRNA-Cys
  3947. Salmonella enterica subsp. enterica serovar Newport str. 0267 tRNA-Cys
  3948. Salmonella enterica subsp. enterica serovar Newport str. #11-2 tRNA-Cys
  3949. Salmonella enterica subsp. enterica serovar Newport str. #11-3 tRNA-Cys
  3950. Salmonella enterica subsp. enterica serovar Newport str. #11-4 tRNA-Cys
  3951. Salmonella enterica subsp. enterica serovar Newport str. 36796 tRNA-Cys
  3952. Salmonella enterica subsp. enterica serovar Newport str. 36799 tRNA-Cys
  3953. Salmonella enterica subsp. enterica serovar Newport str. 36801 tRNA-Cys
  3954. Salmonella enterica subsp. enterica serovar Newport str. 36802 tRNA-Cys
  3955. Salmonella enterica subsp. enterica serovar Newport str. 36803 tRNA-Cys
  3956. Salmonella enterica subsp. enterica serovar Newport str. 36804 tRNA-Cys
  3957. Salmonella enterica subsp. enterica serovar Newport str. 36805 tRNA-Cys
  3958. Salmonella enterica subsp. enterica serovar Newport str. 36807 tRNA-Cys
  3959. Salmonella enterica subsp. enterica serovar Newport str. 637564_17 tRNA-Cys
  3960. Salmonella enterica subsp. enterica serovar Newport str. A182RVB tRNA-Cys
  3961. Salmonella enterica subsp. enterica serovar Newport str. A-211-RVH tRNA-Cys
  3962. Salmonella enterica subsp. enterica serovar Newport str. A-211-TTX tRNA-Cys
  3963. Salmonella enterica subsp. enterica serovar Newport str. CDC 2009K-1331 tRNA-Cys
  3964. Salmonella enterica subsp. enterica serovar Newport str. CDC 2010K-2159 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  3965. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0663 tRNA-Cys
  3966. Salmonella enterica subsp. enterica serovar Newport str. CDC 2012K-0938 tRNA-Cys
  3967. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000597 tRNA-Cys
  3968. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000598 tRNA-Cys
  3969. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000599 tRNA-Cys
  3970. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000826 tRNA-Cys
  3971. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000827 tRNA-Cys
  3972. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000828 tRNA-Cys
  3973. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000829 tRNA-Cys
  3974. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000830 tRNA-Cys
  3975. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000831 tRNA-Cys
  3976. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000832 tRNA-Cys
  3977. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000833 tRNA-Cys
  3978. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000834 tRNA-Cys
  3979. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000835 tRNA-Cys
  3980. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000837 tRNA-Cys
  3981. Salmonella enterica subsp. enterica serovar Newport str. CFSAN000901 tRNA-Cys
  3982. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001633 tRNA-Cys
  3983. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001634 tRNA-Cys
  3984. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001635 tRNA-Cys
  3985. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001636 tRNA-Cys
  3986. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001637 tRNA-Cys
  3987. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001638 tRNA-Cys
  3988. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001639 tRNA-Cys
  3989. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001640 tRNA-Cys
  3990. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001641 tRNA-Cys
  3991. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001642 tRNA-Cys
  3992. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001643 tRNA-Cys
  3993. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001644 tRNA-Cys
  3994. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001645 tRNA-Cys
  3995. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001646 tRNA-Cys
  3996. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001647 tRNA-Cys
  3997. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001648 tRNA-Cys
  3998. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001661 tRNA-Cys
  3999. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001889 tRNA-Cys
  4000. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001890 tRNA-Cys
  4001. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001894 tRNA-Cys
  4002. Salmonella enterica subsp. enterica serovar Newport str. CFSAN001895 tRNA-Cys
  4003. Salmonella enterica subsp. enterica serovar Newport str. CVM17619 tRNA-Cys
  4004. Salmonella enterica subsp. enterica serovar Newport str. CVM18000 tRNA-Cys
  4005. Salmonella enterica subsp. enterica serovar Newport str. CVM18005 tRNA-Cys
  4006. Salmonella enterica subsp. enterica serovar Newport str. CVM 19443 tRNA-Cys
  4007. Salmonella enterica subsp. enterica serovar Newport str. CVM 19447 tRNA-Cys
  4008. Salmonella enterica subsp. enterica serovar Newport str. CVM 19449 tRNA-Cys
  4009. Salmonella enterica subsp. enterica serovar Newport str. CVM 19470 tRNA-Cys
  4010. Salmonella enterica subsp. enterica serovar Newport str. CVM 19536 tRNA-Cys
  4011. Salmonella enterica subsp. enterica serovar Newport str. CVM 19567 tRNA-Cys
  4012. Salmonella enterica subsp. enterica serovar Newport str. CVM 19593 tRNA-Cys
  4013. Salmonella enterica subsp. enterica serovar Newport str. CVM20775 tRNA-Cys
  4014. Salmonella enterica subsp. enterica serovar Newport str. CVM20776 tRNA-Cys
  4015. Salmonella enterica subsp. enterica serovar Newport str. CVM21537 tRNA-Cys
  4016. Salmonella enterica subsp. enterica serovar Newport str. CVM 21538 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4017. Salmonella enterica subsp. enterica serovar Newport str. CVM 21539 tRNA-Cys
  4018. Salmonella enterica subsp. enterica serovar Newport str. CVM 21550 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4019. Salmonella enterica subsp. enterica serovar Newport str. CVM 21554 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4020. Salmonella enterica subsp. enterica serovar Newport str. CVM 21559 tRNA-Cys
  4021. Salmonella enterica subsp. enterica serovar Newport str. CVM 22425 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4022. Salmonella enterica subsp. enterica serovar Newport str. CVM22443 tRNA-Cys
  4023. Salmonella enterica subsp. enterica serovar Newport str. CVM 22462 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4024. Salmonella enterica subsp. enterica serovar Newport str. CVM 22513 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4025. Salmonella enterica subsp. enterica serovar Newport str. CVM22697 tRNA-Cys
  4026. Salmonella enterica subsp. enterica serovar Newport str. CVM22699 tRNA-Cys
  4027. Salmonella enterica subsp. enterica serovar Newport str. CVM22707 tRNA-Cys
  4028. Salmonella enterica subsp. enterica serovar Newport str. CVM24403 tRNA-Cys
  4029. Salmonella enterica subsp. enterica serovar Newport str. CVM30171 tRNA-Cys
  4030. Salmonella enterica subsp. enterica serovar Newport str. CVM 33953 tRNA-Cys
  4031. Salmonella enterica subsp. enterica serovar Newport str. CVM34519 tRNA-Cys
  4032. Salmonella enterica subsp. enterica serovar Newport str. CVM 35185 tRNA-Cys
  4033. Salmonella enterica subsp. enterica serovar Newport str. CVM 35188 tRNA-Cys
  4034. Salmonella enterica subsp. enterica serovar Newport str. CVM 35199 tRNA-Cys
  4035. Salmonella enterica subsp. enterica serovar Newport str. CVM 35202 tRNA-Cys
  4036. Salmonella enterica subsp. enterica serovar Newport str. CVM 37978 tRNA-Cys
  4037. Salmonella enterica subsp. enterica serovar Newport str. CVM 4176 tRNA-Cys
  4038. Salmonella enterica subsp. enterica serovar Newport str. CVM75_1280 tRNA-Cys
  4039. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1357 tRNA-Cys
  4040. Salmonella enterica subsp. enterica serovar Newport str. CVM79_1594 tRNA-Cys
  4041. Salmonella enterica subsp. enterica serovar Newport str. CVM80_2288 tRNA-Cys
  4042. Salmonella enterica subsp. enterica serovar Newport str. CVM N1543 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4043. Salmonella enterica subsp. enterica serovar Newport str. CVM N18486 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4044. Salmonella enterica subsp. enterica serovar Newport str. DC_10-446 tRNA-Cys
  4045. Salmonella enterica subsp. enterica serovar Newport str. DC_10-449 tRNA-Cys
  4046. Salmonella enterica subsp. enterica serovar Newport str. DC_10-450 tRNA-Cys
  4047. Salmonella enterica subsp. enterica serovar Newport str. Henan_3 tRNA-Cys
  4048. Salmonella enterica subsp. enterica serovar Newport str. JS09102 tRNA-Cys
  4049. Salmonella enterica subsp. enterica serovar Newport str. JY-221A-RVX tRNA-Cys
  4050. Salmonella enterica subsp. enterica serovar Newport str. JY-223A-RVX tRNA-Cys
  4051. Salmonella enterica subsp. enterica serovar Newport str. L0167 tRNA-Cys
  4052. Salmonella enterica subsp. enterica serovar Newport str. Levine 15 tRNA-Cys
  4053. Salmonella enterica subsp. enterica serovar Newport str. Levine 1 tRNA-Cys
  4054. Salmonella enterica subsp. enterica serovar Newport str. MA_10EN1469 tRNA-Cys
  4055. Salmonella enterica subsp. enterica serovar Newport str. PL01 tRNA-Cys
  4056. Salmonella enterica subsp. enterica serovar Newport str. Pond080-2TTA tRNA-Cys
  4057. Salmonella enterica subsp. enterica serovar Newport str. PRS_2010_0624 tRNA-Cys
  4058. Salmonella enterica subsp. enterica serovar Newport str. RI_10P068 tRNA-Cys
  4059. Salmonella enterica subsp. enterica serovar Newport str. RI_10P069 tRNA-Cys
  4060. Salmonella enterica subsp. enterica serovar Newport str. RI_10P078 tRNA-Cys
  4061. Salmonella enterica subsp. enterica serovar Newport str. RI_10P079 tRNA-Cys
  4062. Salmonella enterica subsp. enterica serovar Newport str. S09097 tRNA-Cys
  4063. Salmonella enterica subsp. enterica serovar Newport str. S103RVX tRNA-Cys
  4064. Salmonella enterica subsp. enterica serovar Newport str. S-38A-RVX tRNA-Cys
  4065. Salmonella enterica subsp. enterica serovar Newport str. S-49A-RVX tRNA-Cys
  4066. Salmonella enterica subsp. enterica serovar Newport str. SH111077 tRNA-Cys
  4067. Salmonella enterica subsp. enterica serovar Newport str. Shandong_3 tRNA-Cys
  4068. Salmonella enterica subsp. enterica serovar Newport str. SHSN001 tRNA-Cys
  4069. Salmonella enterica subsp. enterica serovar Newport str. SHSN002 tRNA-Cys
  4070. Salmonella enterica subsp. enterica serovar Newport str. SHSN003 tRNA-Cys
  4071. Salmonella enterica subsp. enterica serovar Newport str. SHSN004 tRNA-Cys
  4072. Salmonella enterica subsp. enterica serovar Newport str. SHSN005 tRNA-Cys
  4073. Salmonella enterica subsp. enterica serovar Newport str. SHSN006 tRNA-Cys
  4074. Salmonella enterica subsp. enterica serovar Newport str. SHSN007 tRNA-Cys
  4075. Salmonella enterica subsp. enterica serovar Newport str. SHSN008 tRNA-Cys
  4076. Salmonella enterica subsp. enterica serovar Newport str. SHSN009 tRNA-Cys
  4077. Salmonella enterica subsp. enterica serovar Newport str. SHSN010 tRNA-Cys
  4078. Salmonella enterica subsp. enterica serovar Newport str. SHSN011 tRNA-Cys
  4079. Salmonella enterica subsp. enterica serovar Newport str. SHSN012 tRNA-Cys
  4080. Salmonella enterica subsp. enterica serovar Newport str. SHSN013 tRNA-Cys
  4081. Salmonella enterica subsp. enterica serovar Newport str. SHSN014 tRNA-Cys
  4082. Salmonella enterica subsp. enterica serovar Newport str. SL254 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4083. Salmonella enterica subsp. enterica serovar Newport str. SL317 tRNA-Cys
  4084. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1923 tRNA-Cys
  4085. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1924 tRNA-Cys
  4086. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1925 tRNA-Cys
  4087. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1926 tRNA-Cys
  4088. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1927 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4089. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1928 tRNA-Cys
  4090. Salmonella enterica subsp. enterica serovar Newport str. USDA-ARS-USMARC-1929 tRNA-Cys
  4091. Salmonella enterica subsp. enterica serovar Newport str. USMARC-S3124.1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4092. Salmonella enterica subsp. enterica serovar Newport str. VA_R100506907 tRNA-Cys
  4093. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512570 tRNA-Cys
  4094. Salmonella enterica subsp. enterica serovar Newport str. VA_R100512572 tRNA-Cys
  4095. Salmonella enterica subsp. enterica serovar Newport str. VA_R100804798 tRNA-Cys
  4096. Salmonella enterica subsp. enterica serovar Newport str. VA_R100808502 tRNA-Cys
  4097. Salmonella enterica subsp. enterica serovar Newport str. WA_14881 tRNA-Cys
  4098. Salmonella enterica subsp. enterica serovar Newport str. WA_14882 tRNA-Cys
  4099. Salmonella enterica subsp. enterica serovar Newport str. WA_14885 tRNA-Cys
  4100. Salmonella enterica subsp. enterica serovar Newport str. WA_14900 tRNA-Cys
  4101. Salmonella enterica subsp. enterica serovar Newport tRNA-Cys
  4102. Salmonella enterica subsp. enterica serovar Newyork tRNA-Cys
  4103. Salmonella enterica subsp. enterica serovar Ngili tRNA-Cys
  4104. Salmonella enterica subsp. enterica serovar Nigeria tRNA-Cys
  4105. Salmonella enterica subsp. enterica serovar Nijmegen tRNA-Cys
  4106. Salmonella enterica subsp. enterica serovar Nima tRNA-Cys
  4107. Salmonella enterica subsp. enterica serovar Nitra tRNA-Cys
  4108. Salmonella enterica subsp. enterica serovar Norwich str. CFSAN001077 tRNA-Cys
  4109. Salmonella enterica subsp. enterica serovar Norwich tRNA-Cys
  4110. Salmonella enterica subsp. enterica serovar Nottingham tRNA-Cys
  4111. Salmonella enterica subsp. enterica serovar Noya tRNA-Cys
  4112. Salmonella enterica subsp. enterica serovar Nyanza tRNA-Cys
  4113. Salmonella enterica subsp. enterica serovar Oakland tRNA-Cys
  4114. Salmonella enterica subsp. enterica serovar Obogu tRNA-Cys
  4115. Salmonella enterica subsp. enterica serovar Odozi tRNA-Cys
  4116. Salmonella enterica subsp. enterica serovar Offa tRNA-Cys
  4117. Salmonella enterica subsp. enterica serovar Ohio str. CFSAN001079 tRNA-Cys
  4118. Salmonella enterica subsp. enterica serovar Ohio subsp. enterica serovar Ohio tRNA-Cys
  4119. Salmonella enterica subsp. enterica serovar Okatie tRNA-Cys
  4120. Salmonella enterica subsp. enterica serovar Olten tRNA-Cys
  4121. Salmonella enterica subsp. enterica serovar Omderman tRNA-Cys
  4122. Salmonella enterica subsp. enterica serovar Onderstepoort str. SA20060086 tRNA-Cys
  4123. Salmonella enterica subsp. enterica serovar Onderstepoort tRNA-Cys
  4124. Salmonella enterica subsp. enterica serovar Onireke tRNA-Cys
  4125. Salmonella enterica subsp. enterica serovar Oranienburg str. 0250 tRNA-Cys
  4126. Salmonella enterica subsp. enterica serovar Oranienburg str. 701 tRNA-Cys
  4127. Salmonella enterica subsp. enterica serovar Oranienburg str. S-76 tRNA-Cys
  4128. Salmonella enterica subsp. enterica serovar Oranienburg tRNA-Cys(gca)
  4129. Salmonella enterica subsp. enterica serovar Ordonez tRNA-Cys
  4130. Salmonella enterica subsp. enterica serovar Orientalis tRNA-Cys
  4131. Salmonella enterica subsp. enterica serovar Orion tRNA-Cys
  4132. Salmonella enterica subsp. enterica serovar O Rough:a:- tRNA-Cys
  4133. Salmonella enterica subsp. enterica serovar O rough tRNA-Cys
  4134. Salmonella enterica subsp. enterica serovar Oskarshamn tRNA-Cys
  4135. Salmonella enterica subsp. enterica serovar Oslo tRNA-Cys
  4136. Salmonella enterica subsp. enterica serovar Othmarschen tRNA-Cys
  4137. Salmonella enterica subsp. enterica serovar Ouagadougou tRNA-Cys
  4138. Salmonella enterica subsp. enterica serovar Ouakam str. SA20034636 tRNA-Cys
  4139. Salmonella enterica subsp. enterica serovar Ouakam tRNA-Cys
  4140. Salmonella enterica subsp. enterica serovar Oudwijk tRNA-Cys
  4141. Salmonella enterica subsp. enterica serovar Overschie tRNA-Cys
  4142. Salmonella enterica subsp. enterica serovar Pakistan tRNA-Cys
  4143. Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 tRNA-Cys
  4144. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000600 tRNA-Cys
  4145. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000601 tRNA-Cys
  4146. Salmonella enterica subsp. enterica serovar Panama str. CFSAN000602 tRNA-Cys
  4147. Salmonella enterica subsp. enterica serovar Panama str. SA20030878 tRNA-Cys
  4148. Salmonella enterica subsp. enterica serovar Panama tRNA-Cys(gca)
  4149. Salmonella enterica subsp. enterica serovar Papuana tRNA-Cys
  4150. Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4151. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 11511 tRNA-Cys
  4152. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4153. Salmonella enterica subsp. enterica serovar Paratyphi A str. SA19950809 tRNA-Cys
  4154. Salmonella enterica subsp. enterica serovar Paratyphi A tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4155. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 10719 tRNA-Cys
  4156. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 19940 tRNA-Cys
  4157. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 51962 tRNA-Cys
  4158. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC 8759 tRNA-Cys
  4159. Salmonella enterica subsp. enterica serovar Paratyphi B str. ATCC BAA-1585 tRNA-Cys
  4160. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000527 tRNA-Cys
  4161. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000532 tRNA-Cys
  4162. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000536 tRNA-Cys
  4163. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000540 tRNA-Cys
  4164. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000541 tRNA-Cys
  4165. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000542 tRNA-Cys
  4166. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000545 tRNA-Cys
  4167. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000547 tRNA-Cys
  4168. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000548 tRNA-Cys
  4169. Salmonella enterica subsp. enterica serovar Paratyphi B str. CFSAN000549 tRNA-Cys
  4170. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA42 tRNA-Cys
  4171. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA56 tRNA-Cys
  4172. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA61 tRNA-Cys
  4173. Salmonella enterica subsp. enterica serovar Paratyphi B str. SARA62 tRNA-Cys
  4174. Salmonella enterica subsp. enterica serovar Paratyphi B str. SPB7 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4175. Salmonella enterica subsp. enterica serovar Paratyphi B tRNA-Cys
  4176. Salmonella enterica subsp. enterica serovar Paratyphi B var. L-tartrate + tRNA-Cys
  4177. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000603 tRNA-Cys
  4178. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000604 tRNA-Cys
  4179. Salmonella enterica subsp. enterica serovar Paratyphi C str. CFSAN000605 tRNA-Cys
  4180. Salmonella enterica subsp. enterica serovar Paratyphi C str. RKS4594 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4181. Salmonella enterica subsp. enterica serovar Paratyphi C tRNA-Cys(gca)
  4182. Salmonella enterica subsp. enterica serovar Parkroyal tRNA-Cys
  4183. Salmonella enterica subsp. enterica serovar Pasing tRNA-Cys
  4184. Salmonella enterica subsp. enterica serovar Penarth tRNA-Cys
  4185. Salmonella enterica subsp. enterica serovar Pensacola tRNA-Cys
  4186. Salmonella enterica subsp. enterica serovar Plymouth tRNA-Cys
  4187. Salmonella enterica subsp. enterica serovar Poano tRNA-Cys
  4188. Salmonella enterica subsp. enterica serovar Pomona str. ATCC 10729 tRNA-Cys
  4189. Salmonella enterica subsp. enterica serovar Pomona tRNA-Cys
  4190. Salmonella enterica subsp. enterica serovar Poona str. ATCC BAA-1673 tRNA-Cys
  4191. Salmonella enterica subsp. enterica serovar Poona tRNA-Cys(gca)
  4192. Salmonella enterica subsp. enterica serovar Potsdam tRNA-Cys
  4193. Salmonella enterica subsp. enterica serovar Praha tRNA-Cys
  4194. Salmonella enterica subsp. enterica serovar Pretoria tRNA-Cys
  4195. Salmonella enterica subsp. enterica serovar Pullorum str. 13036 tRNA-Cys
  4196. Salmonella enterica subsp. enterica serovar Pullorum str. 19945 tRNA-Cys
  4197. Salmonella enterica subsp. enterica serovar Pullorum str. ATCC 9120 tRNA-Cys
  4198. Salmonella enterica subsp. enterica serovar Pullorum str. CFSAN000606 tRNA-Cys
  4199. Salmonella enterica subsp. enterica serovar Pullorum str. S06004 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4200. Salmonella enterica subsp. enterica serovar Pullorum tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4201. Salmonella enterica subsp. enterica serovar Putten tRNA-Cys
  4202. Salmonella enterica subsp. enterica serovar Quebec str. S-1267 tRNA-Cys
  4203. Salmonella enterica subsp. enterica serovar -:r:1,5 tRNA-Cys
  4204. Salmonella enterica subsp. enterica serovar Ramatgan tRNA-Cys
  4205. Salmonella enterica subsp. enterica serovar Rauform tRNA-Cys
  4206. Salmonella enterica subsp. enterica serovar Reading subsp. enterica serovar Reading tRNA-Cys
  4207. Salmonella enterica subsp. enterica serovar Redba tRNA-Cys
  4208. Salmonella enterica subsp. enterica serovar Redlands tRNA-Cys
  4209. Salmonella enterica subsp. enterica serovar Remiremont tRNA-Cys
  4210. Salmonella enterica subsp. enterica serovar Remo tRNA-Cys
  4211. Salmonella enterica subsp. enterica serovar Richmond tRNA-Cys
  4212. Salmonella enterica subsp. enterica serovar Rideau tRNA-Cys
  4213. Salmonella enterica subsp. enterica serovar Ridge tRNA-Cys
  4214. Salmonella enterica subsp. enterica serovar Rissen str. 150 tRNA-Cys
  4215. Salmonella enterica subsp. enterica serovar Rissen tRNA-Cys
  4216. Salmonella enterica subsp. enterica serovar Roodepoort tRNA-Cys
  4217. Salmonella enterica subsp. enterica serovar Rostock tRNA-Cys
  4218. Salmonella enterica subsp. enterica serovar Rottnest tRNA-Cys
  4219. Salmonella enterica subsp. enterica serovar Rough:b:1,2 tRNA-Cys
  4220. Salmonella enterica subsp. enterica serovar Rough O:d:1,7 tRNA-Cys
  4221. Salmonella enterica subsp. enterica serovar Rough O:k:1,5 tRNA-Cys
  4222. Salmonella enterica subsp. enterica serovar Rough O:-:- tRNA-Cys
  4223. Salmonella enterica subsp. enterica serovar Rough O:z29 tRNA-Cys
  4224. Salmonella enterica subsp. enterica serovar Rough O:z4,z23: tRNA-Cys
  4225. Salmonella enterica subsp. enterica serovar Rough:r:1,5 tRNA-Cys
  4226. Salmonella enterica subsp. enterica serovar Rough:- tRNA-Cys
  4227. Salmonella enterica subsp. enterica serovar Rough:z10:e,n,z15 tRNA-Cys
  4228. Salmonella enterica subsp. enterica serovar Rovaniemi tRNA-Cys
  4229. Salmonella enterica subsp. enterica serovar Rubislaw str. A4-653 tRNA-Cys
  4230. Salmonella enterica subsp. enterica serovar Rubislaw str. ATCC 10717 tRNA-Cys
  4231. Salmonella enterica subsp. enterica serovar Rubislaw str. SA20030553 tRNA-Cys
  4232. Salmonella enterica subsp. enterica serovar Rubislaw tRNA-Cys
  4233. Salmonella enterica subsp. enterica serovar Ruiru tRNA-Cys
  4234. Salmonella enterica subsp. enterica serovar Saarbruecken tRNA-Cys
  4235. Salmonella enterica subsp. enterica serovar Saintpaul str. 9712 tRNA-Cys
  4236. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000612 tRNA-Cys
  4237. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000618 tRNA-Cys
  4238. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN000619 tRNA-Cys
  4239. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004152 tRNA-Cys
  4240. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004164 tRNA-Cys
  4241. Salmonella enterica subsp. enterica serovar Saintpaul str. CFSAN004166 tRNA-Cys
  4242. Salmonella enterica subsp. enterica serovar Saintpaul str. JO2008 tRNA-Cys
  4243. Salmonella enterica subsp. enterica serovar Saintpaul str. S-70 tRNA-Cys
  4244. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA23 tRNA-Cys
  4245. Salmonella enterica subsp. enterica serovar Saintpaul str. SARA26 tRNA-Cys
  4246. Salmonella enterica subsp. enterica serovar Saintpaul tRNA-Cys
  4247. Salmonella enterica subsp. enterica serovar Salford tRNA-Cys
  4248. Salmonella enterica subsp. enterica serovar Sandiego tRNA-Cys
  4249. Salmonella enterica subsp. enterica serovar Sangera tRNA-Cys
  4250. Salmonella enterica subsp. enterica serovar Sanjuan tRNA-Cys(gca)
  4251. Salmonella enterica subsp. enterica serovar Saphra tRNA-Cys
  4252. Salmonella enterica subsp. enterica serovar Sarajane tRNA-Cys
  4253. Salmonella enterica subsp. enterica serovar Schleissheim tRNA-Cys
  4254. Salmonella enterica subsp. enterica serovar Schwarzengrund str. CVM19633 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4255. Salmonella enterica subsp. enterica serovar Schwarzengrund str. SL480 tRNA-Cys
  4256. Salmonella enterica subsp. enterica serovar Schwarzengrund subsp. enterica serovar Schwarzengrund tRNA-Cys
  4257. Salmonella enterica subsp. enterica serovar Seattle tRNA-Cys
  4258. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Cys
  4259. Salmonella enterica subsp. enterica serovar Sekondi tRNA-Cys
  4260. Salmonella enterica subsp. enterica serovar Sendai str. CFSAN000621 tRNA-Cys
  4261. Salmonella enterica subsp. enterica serovar Sendai tRNA-Cys(gca)
  4262. Salmonella enterica subsp. enterica serovar Senegal tRNA-Cys
  4263. Salmonella enterica subsp. enterica serovar Senftenberg str. 316235162 tRNA-Cys
  4264. Salmonella enterica subsp. enterica serovar Senftenberg str. 361154004 tRNA-Cys
  4265. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-1 tRNA-Cys
  4266. Salmonella enterica subsp. enterica serovar Senftenberg str. 423984-2 tRNA-Cys
  4267. Salmonella enterica subsp. enterica serovar Senftenberg str. 604314 tRNA-Cys
  4268. Salmonella enterica subsp. enterica serovar Senftenberg str. A4-543 tRNA-Cys
  4269. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 tRNA-Cys
  4270. Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 8400 tRNA-Cys
  4271. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004025 tRNA-Cys
  4272. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004030 tRNA-Cys
  4273. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004031 tRNA-Cys
  4274. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004032 tRNA-Cys
  4275. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004033 tRNA-Cys
  4276. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004041 tRNA-Cys
  4277. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004042 tRNA-Cys
  4278. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004043 tRNA-Cys
  4279. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004044 tRNA-Cys
  4280. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004045 tRNA-Cys
  4281. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004047 tRNA-Cys
  4282. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004048 tRNA-Cys
  4283. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004049 tRNA-Cys
  4284. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004052 tRNA-Cys
  4285. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004054 tRNA-Cys
  4286. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004055 tRNA-Cys
  4287. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004059 tRNA-Cys
  4288. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004060 tRNA-Cys
  4289. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004061 tRNA-Cys
  4290. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004062 tRNA-Cys
  4291. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004063 tRNA-Cys
  4292. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004064 tRNA-Cys
  4293. Salmonella enterica subsp. enterica serovar Senftenberg str. CFSAN004065 tRNA-Cys
  4294. Salmonella enterica subsp. enterica serovar Senftenberg str. NC_MB012510-0038 tRNA-Cys
  4295. Salmonella enterica subsp. enterica serovar Senftenberg str. SS209 transfer RNA-Cys
  4296. Salmonella enterica subsp. enterica serovar Senftenberg tRNA-Cys(gca)
  4297. Salmonella enterica subsp. enterica serovar Senneville tRNA-Cys
  4298. Salmonella enterica subsp. enterica serovar Shamba tRNA-Cys
  4299. Salmonella enterica subsp. enterica serovar Shubra tRNA-Cys
  4300. Salmonella enterica subsp. enterica serovar Singapore tRNA-Cys
  4301. Salmonella enterica subsp. enterica serovar Sinstorf tRNA-Cys
  4302. Salmonella enterica subsp. enterica serovar SI Rough:r:1,5 tRNA-Cys
  4303. Salmonella enterica subsp. enterica serovar Sloterdijk str. ATCC 15791 tRNA-Cys
  4304. Salmonella enterica subsp. enterica serovar Soerenga str. 695 tRNA-Cys
  4305. Salmonella enterica subsp. enterica serovar Soerenga tRNA-Cys
  4306. Salmonella enterica subsp. enterica serovar Solt tRNA-Cys
  4307. Salmonella enterica subsp. enterica serovar Somone tRNA-Cys
  4308. Salmonella enterica subsp. enterica serovar Soumbedioune tRNA-Cys
  4309. Salmonella enterica subsp. enterica serovar Southampton tRNA-Cys
  4310. Salmonella enterica subsp. enterica serovar Southbank tRNA-Cys
  4311. Salmonella enterica subsp. enterica serovar Stanley str. ATCC 7308 tRNA-Cys
  4312. Salmonella enterica subsp. enterica serovar Stanley str. CFSAN000623 tRNA-Cys
  4313. Salmonella enterica subsp. enterica serovar Stanley tRNA-Cys(gca)
  4314. Salmonella enterica subsp. enterica serovar Stanleyville str. CFSAN000624 tRNA-Cys
  4315. Salmonella enterica subsp. enterica serovar Stanleyville tRNA-Cys
  4316. Salmonella enterica subsp. enterica serovar Stockholm tRNA-Cys
  4317. Salmonella enterica subsp. enterica serovar Stourbridge tRNA-Cys
  4318. Salmonella enterica subsp. enterica serovar Strathcona tRNA-Cys
  4319. Salmonella enterica subsp. enterica serovar Stuttgart tRNA-Cys
  4320. Salmonella enterica subsp. enterica serovar Suberu tRNA-Cys
  4321. Salmonella enterica subsp. enterica serovar Suelldorf tRNA-Cys
  4322. Salmonella enterica subsp. enterica serovar Sundsvall tRNA-Cys
  4323. Salmonella enterica subsp. enterica serovar Szentes tRNA-Cys
  4324. Salmonella enterica subsp. enterica serovar Tafo tRNA-Cys
  4325. Salmonella enterica subsp. enterica serovar Takoradi tRNA-Cys
  4326. Salmonella enterica subsp. enterica serovar Taksony tRNA-Cys
  4327. Salmonella enterica subsp. enterica serovar Tallahassee str. 0012 tRNA-Cys
  4328. Salmonella enterica subsp. enterica serovar Tallahassee tRNA-Cys
  4329. Salmonella enterica subsp. enterica serovar Tamale tRNA-Cys
  4330. Salmonella enterica subsp. enterica serovar Tamberma tRNA-Cys
  4331. Salmonella enterica subsp. enterica serovar Tananarive tRNA-Cys
  4332. Salmonella enterica subsp. enterica serovar Tanger tRNA-Cys
  4333. Salmonella enterica subsp. enterica serovar Tchad tRNA-Cys
  4334. Salmonella enterica subsp. enterica serovar Techimani tRNA-Cys
  4335. Salmonella enterica subsp. enterica serovar Teddington tRNA-Cys
  4336. Salmonella enterica subsp. enterica serovar Tees tRNA-Cys
  4337. Salmonella enterica subsp. enterica serovar Teko tRNA-Cys
  4338. Salmonella enterica subsp. enterica serovar Telaviv tRNA-Cys
  4339. Salmonella enterica subsp. enterica serovar Telelkebir tRNA-Cys
  4340. Salmonella enterica subsp. enterica serovar Telhashomer tRNA-Cys
  4341. Salmonella enterica subsp. enterica serovar Teltow tRNA-Cys
  4342. Salmonella enterica subsp. enterica serovar Tennessee str. 2691 tRNA-Cys
  4343. Salmonella enterica subsp. enterica serovar Tennessee str. 3133 tRNA-Cys
  4344. Salmonella enterica subsp. enterica serovar Tennessee str. 4535 tRNA-Cys
  4345. Salmonella enterica subsp. enterica serovar Tennessee str. PBO2007 tRNA-Cys
  4346. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-19 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4347. Salmonella enterica subsp. enterica serovar Tennessee str. TXSC_TXSC08-21 tRNA-Cys
  4348. Salmonella enterica subsp. enterica serovar Tennessee tRNA-Cys
  4349. Salmonella enterica subsp. enterica serovar Teshie tRNA-Cys
  4350. Salmonella enterica subsp. enterica serovar Texas tRNA-Cys
  4351. Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 tRNA-Cys
  4352. Salmonella enterica subsp. enterica serovar Thompson str. CFSAN000625 tRNA-Cys
  4353. Salmonella enterica subsp. enterica serovar Thompson str. RM6836 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4354. Salmonella enterica subsp. enterica serovar Thompson tRNA-Cys(gca)
  4355. Salmonella enterica subsp. enterica serovar Tilene tRNA-Cys
  4356. Salmonella enterica subsp. enterica serovar Togba tRNA-Cys
  4357. Salmonella enterica subsp. enterica serovar Toucra tRNA-Cys
  4358. Salmonella enterica subsp. enterica serovar Toulon tRNA-Cys
  4359. Salmonella enterica subsp. enterica serovar Treforest tRNA-Cys
  4360. Salmonella enterica subsp. enterica serovar Tucson tRNA-Cys
  4361. Salmonella enterica subsp. enterica serovar Tudu tRNA-Cys
  4362. Salmonella enterica subsp. enterica serovar Typhimurium str. 104772 tRNA-Cys
  4363. Salmonella enterica subsp. enterica serovar Typhimurium str. 108402 tRNA-Cys
  4364. Salmonella enterica subsp. enterica serovar Typhimurium str. 116045 tRNA-Cys
  4365. Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4366. Salmonella enterica subsp. enterica serovar Typhimurium str. 34502 tRNA-Cys
  4367. Salmonella enterica subsp. enterica serovar Typhimurium str. 35423 tRNA-Cys
  4368. Salmonella enterica subsp. enterica serovar Typhimurium str. 36618 tRNA-Cys
  4369. Salmonella enterica subsp. enterica serovar Typhimurium str. 798 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4370. Salmonella enterica subsp. enterica serovar Typhimurium str. 86-0368 tRNA-Cys
  4371. Salmonella enterica subsp. enterica serovar Typhimurium str. 95799 tRNA-Cys
  4372. Salmonella enterica subsp. enterica serovar Typhimurium str. 98346 tRNA-Cys
  4373. Salmonella enterica subsp. enterica serovar Typhimurium str. AZ 057 tRNA-Cys
  4374. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1153 tRNA-Cys
  4375. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1158 tRNA-Cys
  4376. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1277 tRNA-Cys
  4377. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1283 tRNA-Cys
  4378. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC_2009K1288 tRNA-Cys
  4379. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-1640 tRNA-Cys
  4380. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2009K-2059 tRNA-Cys
  4381. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2010K-1587 tRNA-Cys
  4382. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-0870 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4383. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC 2011K-1702 tRNA-Cys
  4384. Salmonella enterica subsp. enterica serovar Typhimurium str. CDC H2662 tRNA-Cys
  4385. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000643 tRNA-Cys
  4386. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000648 tRNA-Cys
  4387. Salmonella enterica subsp. enterica serovar Typhimurium str. CFSAN000653 tRNA-Cys
  4388. Salmonella enterica subsp. enterica serovar Typhimurium str. D23580 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4389. Salmonella enterica subsp. enterica serovar Typhimurium str. DT104 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4390. Salmonella enterica subsp. enterica serovar Typhimurium str. DT2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4391. Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4392. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4_delta.ramA::kan tRNA-Cys
  4393. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2-4 tRNA-Cys
  4394. Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4395. Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 tRNA-Cys
  4396. Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4397. Salmonella enterica subsp. enterica serovar Typhimurium str. ST1489 tRNA-Cys
  4398. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4581 tRNA-Cys
  4399. Salmonella enterica subsp. enterica serovar Typhimurium str. ST4/74 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4400. Salmonella enterica subsp. enterica serovar Typhimurium str. STm10 tRNA-Cys
  4401. Salmonella enterica subsp. enterica serovar Typhimurium str. STm11 tRNA-Cys
  4402. Salmonella enterica subsp. enterica serovar Typhimurium str. STm12 tRNA-Cys
  4403. Salmonella enterica subsp. enterica serovar Typhimurium str. STm1 tRNA-Cys
  4404. Salmonella enterica subsp. enterica serovar Typhimurium str. STm2 tRNA-Cys
  4405. Salmonella enterica subsp. enterica serovar Typhimurium str. STm3 tRNA-Cys
  4406. Salmonella enterica subsp. enterica serovar Typhimurium str. STm4 tRNA-Cys
  4407. Salmonella enterica subsp. enterica serovar Typhimurium str. STm5 tRNA-Cys
  4408. Salmonella enterica subsp. enterica serovar Typhimurium str. STm6 tRNA-Cys
  4409. Salmonella enterica subsp. enterica serovar Typhimurium str. STm7 tRNA-Cys
  4410. Salmonella enterica subsp. enterica serovar Typhimurium str. STm8 tRNA-Cys
  4411. Salmonella enterica subsp. enterica serovar Typhimurium str. STm9 tRNA-Cys
  4412. Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4413. Salmonella enterica subsp. enterica serovar Typhimurium str. U288 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4414. Salmonella enterica subsp. enterica serovar Typhimurium str. UK-1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4415. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1808 tRNA-Cys
  4416. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 tRNA-Cys
  4417. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1880 tRNA-Cys
  4418. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1896 tRNA-Cys
  4419. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 tRNA-Cys
  4420. Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1899 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4421. Salmonella enterica subsp. enterica serovar Typhimurium subsp. enterica serovar Typhimurium tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4422. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN001921 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4423. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- str. CFSAN004345 tRNA-Cys
  4424. Salmonella enterica subsp. enterica serovar Typhimurium var. 5- tRNA-Cys
  4425. Salmonella enterica subsp. enterica serovar Typhimurium var. Copenhagen str. 0084 tRNA-Cys
  4426. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,[5],12:i:- tRNA-Cys
  4427. Salmonella enterica subsp. enterica serovar Typhimurium var. monophasic 4,5,12:i:- tRNA-Cys
  4428. Salmonella enterica subsp. enterica serovar Typhi str. 404ty tRNA-Cys
  4429. Salmonella enterica subsp. enterica serovar Typhi str. AG3 tRNA-Cys
  4430. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000626 tRNA-Cys
  4431. Salmonella enterica subsp. enterica serovar Typhi str. CFSAN000628 tRNA-Cys
  4432. Salmonella enterica subsp. enterica serovar Typhi str. CT18 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4433. Salmonella enterica subsp. enterica serovar Typhi str. P-stx-12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4434. Salmonella enterica subsp. enterica serovar Typhi str. STH2370 tRNA-Cys
  4435. Salmonella enterica subsp. enterica serovar Typhi str. Ty21a tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4436. Salmonella enterica subsp. enterica serovar Typhi str. Ty2 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4437. Salmonella enterica subsp. enterica serovar Typhisuis str. CFSAN000654 tRNA-Cys
  4438. Salmonella enterica subsp. enterica serovar Typhisuis tRNA-Cys(gca)
  4439. Salmonella enterica subsp. enterica serovar Typhi tRNA-Cys(gca)
  4440. Salmonella enterica subsp. enterica serovar Tyresoe tRNA-Cys
  4441. Salmonella enterica subsp. enterica serovar Uganda str. R8-3404 tRNA-Cys
  4442. Salmonella enterica subsp. enterica serovar Uganda tRNA-Cys
  4443. Salmonella enterica subsp. enterica serovar Uganda var. 15+ tRNA-Cys
  4444. Salmonella enterica subsp. enterica serovar Ughelli tRNA-Cys
  4445. Salmonella enterica subsp. enterica serovar Ullevi tRNA-Cys
  4446. Salmonella enterica subsp. enterica serovar Umbilo tRNA-Cys
  4447. Salmonella enterica subsp. enterica serovar Uppsala tRNA-Cys
  4448. Salmonella enterica subsp. enterica serovar Urbana str. ATCC 9261 tRNA-Cys
  4449. Salmonella enterica subsp. enterica serovar Urbana str. R8-2977 tRNA-Cys
  4450. Salmonella enterica subsp. enterica serovar Urbana tRNA-Cys
  4451. Salmonella enterica subsp. enterica serovar Utah tRNA-Cys
  4452. Salmonella enterica subsp. enterica serovar Uzaramo tRNA-Cys
  4453. Salmonella enterica subsp. enterica serovar Vaertan tRNA-Cys
  4454. Salmonella enterica subsp. enterica serovar Vancouver tRNA-Cys
  4455. Salmonella enterica subsp. enterica serovar Vejle tRNA-Cys
  4456. Salmonella enterica subsp. enterica serovar Veneziana tRNA-Cys
  4457. Salmonella enterica subsp. enterica serovar Victoria tRNA-Cys
  4458. Salmonella enterica subsp. enterica serovar Vinohrady tRNA-Cys
  4459. Salmonella enterica subsp. enterica serovar Virchow str. ATCC 51955 tRNA-Cys
  4460. Salmonella enterica subsp. enterica serovar Virchow str. SL491 tRNA-Cys
  4461. Salmonella enterica subsp. enterica serovar Virchow str. SVQ1 tRNA-Cys
  4462. Salmonella enterica subsp. enterica serovar Virchow tRNA-Cys
  4463. Salmonella enterica subsp. enterica serovar Virginia str. SA19971529 tRNA-Cys
  4464. Salmonella enterica subsp. enterica serovar Virginia tRNA-Cys
  4465. Salmonella enterica subsp. enterica serovar Vitkin tRNA-Cys
  4466. Salmonella enterica subsp. enterica serovar Volkmarsdorf tRNA-Cys
  4467. Salmonella enterica subsp. enterica serovar Vom tRNA-Cys
  4468. Salmonella enterica subsp. enterica serovar Vuadens tRNA-Cys
  4469. Salmonella enterica subsp. enterica serovar Waedenswil tRNA-Cys
  4470. Salmonella enterica subsp. enterica serovar Wagenia tRNA-Cys
  4471. Salmonella enterica subsp. enterica serovar Wandsworth str. A4-580 tRNA-Cys
  4472. Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 tRNA-Cys
  4473. Salmonella enterica subsp. enterica serovar Wandsworth tRNA-Cys
  4474. Salmonella enterica subsp. enterica serovar Wangata tRNA-Cys
  4475. Salmonella enterica subsp. enterica serovar Warnow tRNA-Cys
  4476. Salmonella enterica subsp. enterica serovar Warragul tRNA-Cys
  4477. Salmonella enterica subsp. enterica serovar Washington tRNA-Cys
  4478. Salmonella enterica subsp. enterica serovar Wa tRNA-Cys
  4479. Salmonella enterica subsp. enterica serovar Waycross tRNA-Cys
  4480. Salmonella enterica subsp. enterica serovar Wedding tRNA-Cys
  4481. Salmonella enterica subsp. enterica serovar Welikade tRNA-Cys
  4482. Salmonella enterica subsp. enterica serovar Weltevreden str. 1655 tRNA-Cys
  4483. Salmonella enterica subsp. enterica serovar Weltevreden str. 2007-60-3289-1 tRNA-Cys
  4484. Salmonella enterica subsp. enterica serovar Weltevreden tRNA-Cys(gca)
  4485. Salmonella enterica subsp. enterica serovar Wentworth tRNA-Cys
  4486. Salmonella enterica subsp. enterica serovar Wernigerode tRNA-Cys
  4487. Salmonella enterica subsp. enterica serovar Weslaco str. 247K tRNA-Cys
  4488. Salmonella enterica subsp. enterica serovar Weslaco tRNA-Cys
  4489. Salmonella enterica subsp. enterica serovar Westhampton tRNA-Cys
  4490. Salmonella enterica subsp. enterica serovar Westminster tRNA-Cys
  4491. Salmonella enterica subsp. enterica serovar Weston tRNA-Cys
  4492. Salmonella enterica subsp. enterica serovar Weybridge tRNA-Cys
  4493. Salmonella enterica subsp. enterica serovar Widemarsh tRNA-Cys
  4494. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000656 tRNA-Cys
  4495. Salmonella enterica subsp. enterica serovar Wien str. CFSAN000657 tRNA-Cys
  4496. Salmonella enterica subsp. enterica serovar Wien tRNA-Cys
  4497. Salmonella enterica subsp. enterica serovar Wilhelmsburg tRNA-Cys
  4498. Salmonella enterica subsp. enterica serovar Winterthur tRNA-Cys
  4499. Salmonella enterica subsp. enterica serovar Woodhull tRNA-Cys
  4500. Salmonella enterica subsp. enterica serovar Woodinville tRNA-Cys
  4501. Salmonella enterica subsp. enterica serovar Worthington str. ATCC 9607 tRNA-Cys
  4502. Salmonella enterica subsp. enterica serovar Worthington tRNA-Cys
  4503. Salmonella enterica subsp. enterica serovar Wyldegreen tRNA-Cys
  4504. Salmonella enterica subsp. enterica serovar Yaba tRNA-Cys
  4505. Salmonella enterica subsp. enterica serovar Yolo tRNA-Cys
  4506. Salmonella enterica subsp. enterica serovar Yoruba tRNA-Cys
  4507. Salmonella enterica subsp. enterica serovar Yovokome str. S-1850 tRNA-Cys
  4508. Salmonella enterica subsp. enterica serovar Yovokome tRNA-Cys
  4509. Salmonella enterica subsp. enterica serovar Zaiman tRNA-Cys
  4510. Salmonella enterica subsp. enterica serovar Zanzibar tRNA-Cys
  4511. Salmonella enterica subsp. enterica serovar Zega tRNA-Cys
  4512. Salmonella enterica subsp. enterica subsp. enterica tRNA-Cys(gca)
  4513. Salmonella enterica subsp. houtenae serovar 1,40:z4,z32:- tRNA-Cys
  4514. Salmonella enterica subsp. houtenae serovar 16:z4,z32:- tRNA-Cys
  4515. Salmonella enterica subsp. houtenae serovar 18:z36,z38:- tRNA-Cys
  4516. Salmonella enterica subsp. houtenae serovar 21:z4,z23:- tRNA-Cys
  4517. Salmonella enterica subsp. houtenae serovar 38:z4,z23:- tRNA-Cys
  4518. Salmonella enterica subsp. houtenae serovar 40:z4,z24:- tRNA-Cys
  4519. Salmonella enterica subsp. houtenae serovar 40:z4,z32:- tRNA-Cys
  4520. Salmonella enterica subsp. houtenae serovar 41:z4,z23:- tRNA-Cys
  4521. Salmonella enterica subsp. houtenae serovar 43:z4 tRNA-Cys
  4522. Salmonella enterica subsp. houtenae serovar Houten tRNA-Cys
  4523. Salmonella enterica subsp. houtenae serovar 43:z4,z32:- tRNA-Cys
  4524. Salmonella enterica subsp. houtenae serovar 44:z36[z38]:- tRNA-Cys
  4525. Salmonella enterica subsp. houtenae serovar 44:z36,[z38]:- tRNA-Cys
  4526. Salmonella enterica subsp. houtenae serovar 44:z4,z23:- tRNA-Cys
  4527. Salmonella enterica subsp. houtenae serovar 44:z4,z24:- tRNA-Cys
  4528. Salmonella enterica subsp. houtenae serovar 45:g,z51:- tRNA-Cys
  4529. Salmonella enterica subsp. houtenae serovar 48:g,z51:- tRNA-Cys
  4530. Salmonella enterica subsp. houtenae serovar 48:z4,z32:- tRNA-Cys
  4531. Salmonella enterica subsp. houtenae serovar 50:g,z51:- str. 01-0133 tRNA-Cys
  4532. Salmonella enterica subsp. houtenae serovar 50:g,z51:- tRNA-Cys
  4533. Salmonella enterica subsp. houtenae serovar 50:z4,z23:- tRNA-Cys
  4534. Salmonella enterica subsp. houtenae serovar 53:z4,z23:- tRNA-Cys
  4535. Salmonella enterica subsp. houtenae serovar Houten tRNA-Cys(gca)
  4536. Salmonella enterica subsp. houtenae serovar O:11:g,z25:- tRNA-Cys
  4537. Salmonella enterica subsp. houtenae str. ATCC BAA-1581 tRNA-Cys
  4538. Salmonella enterica subsp. houtenae str. CFSAN000552 tRNA-Cys
  4539. Salmonella enterica subsp. houtenae str. CFSAN000557 tRNA-Cys
  4540. Salmonella enterica subsp. houtenae tRNA-Cys(gca)
  4541. Salmonella enterica subsp. indica serovar 41:b:1,7 tRNA-Cys
  4542. Salmonella enterica subsp. indica serovar 45:a:e,n,x tRNA-Cys
  4543. Salmonella enterica subsp. indica serovar 6,14,25:z10:1,(2),7 str. 1121 tRNA-Cys
  4544. Salmonella enterica subsp. indica serovar Marseille tRNA-Cys
  4545. Salmonella enterica subsp. indica tRNA-Cys(gca)
  4546. Salmonella enterica subsp. salamae serovar 13,22:z:- tRNA-Cys
  4547. Salmonella enterica subsp. salamae serovar 16:m,t:- tRNA-Cys
  4548. Salmonella enterica subsp. salamae serovar 18:z10:z6 tRNA-Cys
  4549. Salmonella enterica subsp. salamae serovar 30:1,z28:z6 tRNA-Cys
  4550. Salmonella enterica subsp. salamae serovar 3,10:b:e,n,x tRNA-Cys
  4551. Salmonella enterica subsp. salamae serovar 42:b:1,5 tRNA-Cys
  4552. Salmonella enterica subsp. salamae serovar 42:f,g,t:-- tRNA-Cys
  4553. Salmonella enterica subsp. salamae serovar 42:r:- tRNA-Cys
  4554. Salmonella enterica subsp. salamae serovar 42:z:1,5 tRNA-Cys
  4555. Salmonella enterica subsp. salamae serovar 47:a:1,5 tRNA-Cys
  4556. Salmonella enterica subsp. salamae serovar 47:b:1,5 tRNA-Cys
  4557. Salmonella enterica subsp. salamae serovar 48:d:z6 tRNA-Cys
  4558. Salmonella enterica subsp. salamae serovar 48:z:e,n,x,z15 tRNA-Cys
  4559. Salmonella enterica subsp. salamae serovar 55:k:z39 str. 1315K tRNA-Cys
  4560. Salmonella enterica subsp. salamae serovar 56:b:[1,5] tRNA-Cys
  4561. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x str. 1369-73 tRNA-Cys
  4562. Salmonella enterica subsp. salamae serovar 56:z10:e,n,x tRNA-Cys
  4563. Salmonella enterica subsp. salamae serovar 57:z29:z42 tRNA-Cys
  4564. Salmonella enterica subsp. salamae serovar 58:a:- tRNA-Cys
  4565. Salmonella enterica subsp. salamae serovar 58:d:z6 tRNA-Cys
  4566. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 str. 00-0163 tRNA-Cys
  4567. Salmonella enterica subsp. salamae serovar 58:l,z13,z28:z6 tRNA-Cys
  4568. Salmonella enterica subsp. salamae serovar 60:g,m,t:z6 tRNA-Cys
  4569. Salmonella enterica subsp. salamae serovar 6,7:m,t:- tRNA-Cys
  4570. Salmonella enterica subsp. salamae serovar Greenside tRNA-Cys(gca)
  4571. Salmonella enterica subsp. salamae serovar Sofia tRNA-Cys
  4572. Salmonella enterica subsp. salamae serovar Springs tRNA-Cys
  4573. Salmonella enterica subsp. salamae str. CFSAN000559 tRNA-Cys
  4574. Salmonella enterica subsp. salamae tRNA-Cys(gca)
  4575. Salmonella enterica subsp. VII serovar 1,40:g,z51:-- tRNA-Cys
  4576. Salmonella enterica subsp. VII serovar 40:z4,z24:[z39] tRNA-Cys
  4577. Salmonella enterica subsp. VII str. CFSAN000554 tRNA-Cys
  4578. Salmonella enterica tRNA-Cys(gca)
  4579. Salmonella sp. 14ESS1282 tRNA-Cys
  4580. Salmonella sp. 15E65 tRNA-Cys
  4581. Salmonella sp. 2018103 tRNA-Cys
  4582. Salmonella sp. 32010201201800099SM tRNA-Cys
  4583. Salmonella sp. 32010601-2015-00010-FB-01-SM-01 tRNA-Cys
  4584. Salmonella sp. 32010601-2015-00137-FB-01-SM-01 tRNA-Cys
  4585. Salmonella sp. 32010601201600049SM tRNA-Cys
  4586. Salmonella sp. 32010601201600067SM tRNA-Cys
  4587. Salmonella sp. 32010601201800023SM tRNA-Cys
  4588. Salmonella sp. 32010601201800030SM tRNA-Cys
  4589. Salmonella sp. 32011103201800031SM tRNA-Cys
  4590. Salmonella sp. 32011103201800106SM tRNA-Cys
  4591. Salmonella sp. 32011401201800036SM tRNA-Cys
  4592. Salmonella sp. 32011401-201800074SM tRNA-Cys
  4593. Salmonella sp. 32011501201800079SM tRNA-Cys
  4594. Salmonella sp. 32011602201600097SM tRNA-Cys
  4595. Salmonella sp. 32011602201600105SM tRNA-Cys
  4596. Salmonella sp. 32011602201800010SM tRNA-Cys
  4597. Salmonella sp. 32011602201800014SM tRNA-Cys
  4598. Salmonella sp. 32011801201800027SM tRNA-Cys
  4599. Salmonella sp. 32020114201800008SM tRNA-Cys
  4600. Salmonella sp. 32020201-2017-00050-FB-01-SM-01 tRNA-Cys
  4601. Salmonella sp. 32020210201800012SM tRNA-Cys
  4602. Salmonella sp. 32020301-2015-00098-FB-01-SM-01 tRNA-Cys
  4603. Salmonella sp. 32020501-2015-00069-FB-01-SM-01 tRNA-Cys
  4604. Salmonella sp. 32020501-2019-00039 tRNA-Cys
  4605. Salmonella sp. 32020501-2019-00040 tRNA-Cys
  4606. Salmonella sp. 32020501-2019-00041 tRNA-Cys
  4607. Salmonella sp. 32020501-2019-00044 tRNA-Cys
  4608. Salmonella sp. 32020501-2019-00050 tRNA-Cys
  4609. Salmonella sp. 32020501-2019-00052 tRNA-Cys
  4610. Salmonella sp. 32020509201800054SM tRNA-Cys
  4611. Salmonella sp. 32020509201800068SM tRNA-Cys
  4612. Salmonella sp. 32020512-2019-00017 tRNA-Cys
  4613. Salmonella sp. 32020614-2019-00048 tRNA-Cys
  4614. Salmonella sp. 32021105201800037SM tRNA-Cys
  4615. Salmonella sp. 32031101201600128SM tRNA-Cys
  4616. Salmonella sp. 3203110320150095SM tRNA-Cys
  4617. Salmonella sp. 3203110320150106SM tRNA-Cys
  4618. Salmonella sp. 32031103201600220SM tRNA-Cys
  4619. Salmonella sp. 32031103201600241SM tRNA-Cys
  4620. Salmonella sp. 32031103201600284SM tRNA-Cys
  4621. Salmonella sp. 32031103201600383SM tRNA-Cys
  4622. Salmonella sp. 3203110320160044 tRNA-Cys
  4623. Salmonella sp. 3203110320160052 tRNA-Cys
  4624. Salmonella sp. 3203110320160127 tRNA-Cys
  4625. Salmonella sp. 3203110320160165 tRNA-Cys
  4626. Salmonella sp. 3203110320160211 tRNA-Cys
  4627. Salmonella sp. 32031103-2018-00083-FB-01-SM-01 tRNA-Cys
  4628. Salmonella sp. 32031103-2018-0023-FB-01-SM-01 tRNA-Cys
  4629. Salmonella sp. 32040202-2015-00022-FB-01-SM-01 tRNA-Cys
  4630. Salmonella sp. 32040203201700040FB01SM01 tRNA-Cys
  4631. Salmonella sp. 32040203201700113FB01SM01 tRNA-Cys
  4632. Salmonella sp. 32040203-2019-00004 tRNA-Cys
  4633. Salmonella sp. 32040203-2019-00032 tRNA-Cys
  4634. Salmonella sp. 32040203-2019-00058 tRNA-Cys
  4635. Salmonella sp. 32040203-2019-00061 tRNA-Cys
  4636. Salmonella sp. 32040203-2019-00097 tRNA-Cys
  4637. Salmonella sp. 32040203-2019-00118 tRNA-Cys
  4638. Salmonella sp. 32040203-2019-00127 tRNA-Cys
  4639. Salmonella sp. 32040203-2019-00133 tRNA-Cys
  4640. Salmonella sp. 32040203-2019-00159 tRNA-Cys
  4641. Salmonella sp. 32040203-2019-00173 tRNA-Cys
  4642. Salmonella sp. 32040209201700048FB01SM01 tRNA-Cys
  4643. Salmonella sp. 32048101-2015-00023-GS-01-SM-01 tRNA-Cys
  4644. Salmonella sp. 32048101-2015-00025-GS-01-SM-01 tRNA-Cys
  4645. Salmonella sp. 32058101201500184GS-01-SM-01 tRNA-Cys
  4646. Salmonella sp. 32070006-2019-00075 tRNA-Cys
  4647. Salmonella sp. 32070301201500052SM tRNA-Cys
  4648. Salmonella sp. 32070601201500089SM tRNA-Cys
  4649. Salmonella sp. 32070601201800144SM tRNA-Cys
  4650. Salmonella sp. 32080201-2017-00039-FB-01-SM-01 tRNA-Cys
  4651. Salmonella sp. 32081101-2017-00024-FB-01-SM-01 tRNA-Cys
  4652. Salmonella sp. 32082101201600294FB01SM01 tRNA-Cys
  4653. Salmonella sp. 32082101-2017-00322-FB-01-SM-01 tRNA-Cys
  4654. Salmonella sp. 32082101-2019-00528 tRNA-Cys
  4655. Salmonella sp. 32090202-2015-00079-FB-01-SM-01 tRNA-Cys
  4656. Salmonella sp. 32100201201700021SM tRNA-Cys
  4657. Salmonella sp. 32100201201700044SM tRNA-Cys
  4658. Salmonella sp. 32100201201700098SM tRNA-Cys
  4659. Salmonella sp. 32100201201700099SM tRNA-Cys
  4660. Salmonella sp. 32100201201700133SM tRNA-Cys
  4661. Salmonella sp. 32100202201700047SM tRNA-Cys
  4662. Salmonella sp. 32100202201700100SM tRNA-Cys
  4663. Salmonella sp. 32101201-2018-00131-FB-01-SM-01 tRNA-Cys
  4664. Salmonella sp. 32118201201500025SM tRNA-Cys
  4665. Salmonella sp. 32120201201500036SM tRNA-Cys
  4666. Salmonella sp. 32120201201600049SM tRNA-Cys
  4667. Salmonella sp. 32120201201600070SM tRNA-Cys
  4668. Salmonella sp. 32120201201700095FB-01-SM-01 tRNA-Cys
  4669. Salmonella sp. 32120201201700135FB-01-SM-01 tRNA-Cys
  4670. Salmonella sp. 32120201201700237FB-01-SM-01 tRNA-Cys
  4671. Salmonella sp. 32120202201500105SM tRNA-Cys
  4672. Salmonella sp. 32120202201500174SM tRNA-Cys
  4673. Salmonella sp. 32120202201600072SM tRNA-Cys
  4674. Salmonella sp. 32120202201600097SM tRNA-Cys
  4675. Salmonella sp. 32120202201600158SM tRNA-Cys
  4676. Salmonella sp. 32120203201500024SM tRNA-Cys
  4677. Salmonella sp. 32120203201700065FB-01-SM-01 tRNA-Cys
  4678. Salmonella sp. 32130201201500050SM tRNA-Cys
  4679. Salmonella sp. 32130201-2017-00038SM tRNA-Cys
  4680. Salmonella sp. 32132402-2017-00107SM tRNA-Cys
  4681. Salmonella sp. 3C tRNA-Cys
  4682. Salmonella sp. 3DZ2-4SM tRNA-Cys
  4683. Salmonella sp. CVCC 1806 tRNA-Cys
  4684. Salmonella sp. D5-9891 tRNA-Cys
  4685. Salmonella sp. gx-f7 tRNA-Cys
  4686. Salmonella sp. gx-f9 tRNA-Cys
  4687. Salmonella sp. hn-f5 tRNA-Cys
  4688. Salmonella sp. hn-h2 tRNA-Cys
  4689. Salmonella sp. hn-h4 tRNA-Cys
  4690. Salmonella sp. HNK130 tRNA-Cys
  4691. Salmonella sp. JS051105201500009SM tRNA-Cys
  4692. Salmonella sp. L-S1857 tRNA-Cys
  4693. Salmonella sp. L-S2921 tRNA-Cys
  4694. Salmonella sp. NCTC 7297 tRNA-Cys(gca)
  4695. Salmonella sp. S13 tRNA-Cys
  4696. Salmonella sp. SAL-007 tRNA-Cys
  4697. Salmonella sp. SAL-020 tRNA-Cys
  4698. Salmonella sp. SAL-045 tRNA-Cys
  4699. Salmonella sp. SCFS4 tRNA-Cys
  4700. Salmonella sp. sc-h42 tRNA-Cys
  4701. Salmonella sp. sc-h43 tRNA-Cys
  4702. Salmonella sp. SJTUF14076 tRNA-Cys
  4703. Salmonella sp. SJTUF14146 tRNA-Cys
  4704. Salmonella sp. SJTUF14152 tRNA-Cys
  4705. Salmonella sp. SJTUF14154 tRNA-Cys
  4706. Salmonella sp. SJTUF14170 tRNA-Cys
  4707. Salmonella sp. SJTUF14178 tRNA-Cys
  4708. Salmonella sp. SJTUF14523 tRNA-Cys
  4709. Salmonella sp. SJTUF15034 tRNA-Cys
  4710. Salmonella sp. SSDFZ54 tRNA-Cys
  4711. Salmonella sp. SSDFZ69 tRNA-Cys
  4712. Salmonella sp. WGH-01 tRNA-Cys
  4713. Salmonella sp. XN2 tRNA-Cys
  4714. Salmonella sp. zj-f100 tRNA-Cys
  4715. Salmonella sp. zj-f50 tRNA-Cys
  4716. Salmonella sp. zj-f54 tRNA-Cys
  4717. Salmonella sp. zj-f60 tRNA-Cys
  4718. Salmonella sp. zj-f75 tRNA-Cys
  4719. Salmonella sp. zj-f78 tRNA-Cys
  4720. Salmonella sp. zj-f95 tRNA-Cys
  4721. Serratia entomophila tRNA-Cys(gca)
  4722. Serratia ficaria tRNA-Cys(gca)
  4723. Serratia fonticola tRNA-Cys(gca)
  4724. Serratia grimesii tRNA-Cys
  4725. Serratia liquefaciens ATCC 27592 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4726. Serratia liquefaciens FK01 tRNA-Cys
  4727. Serratia liquefaciens tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4728. Serratia odorifera DSM 4582 tRNA-Cys
  4729. Serratia odorifera tRNA-Cys(gca)
  4730. Serratia oryzae tRNA-Cys
  4731. Serratia plymuthica 4Rx13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4732. Serratia plymuthica A30 tRNA-Cys
  4733. Serratia plymuthica AS9 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4734. Serratia inhibens PRI-2C tRNA-Cys
  4735. Serratia plymuthica RVH1 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4736. Serratia plymuthica S13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4737. Serratia plymuthica tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4738. Serratia proteamaculans 568 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4739. Serratia proteamaculans tRNA-Cys(gca)
  4740. Serratia quinivorans tRNA-Cys(gca)
  4741. Serratia rubidaea tRNA-Cys(gca)
  4742. Serratia silvae tRNA-Cys
  4743. Serratia sp. 14-2641 tRNA-Cys
  4744. Serratia sp. 3ACOL1 tRNA-Cys
  4745. Serratia sp. Ag1 tRNA-Cys
  4746. Serratia sp. Ag2 tRNA-Cys
  4747. Serratia sp. AS12 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4748. Serratia sp. AS13 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4749. Serratia sp. C2(1) tRNA-Cys
  4750. Serratia sp. C2(2) tRNA-Cys
  4751. Serratia sp. DD3 tRNA-Cys
  4752. Serratia sp. FGI94 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4753. Serratia sp. JUb9 tRNA-Cys
  4754. Serratia rhizosphaerae tRNA-Cys
  4755. Serratia sp. (in: enterobacteria) tRNA-Cys
  4756. Serratia sp. MYb239 tRNA-Cys
  4757. Serratia sp. OS31 tRNA-Cys
  4758. Serratia sp. P2ACOL2 tRNA-Cys
  4759. Serratia sp. PAMC26656 tRNA-Cys
  4760. Serratia sp. PL17 tRNA-Cys
  4761. Serratia sp. root2 tRNA-Cys
  4762. Serratia inhibens tRNA-Cys
  4763. Serratia sp. Tan611 Cys tRNA
  4764. Serratia sp. UGAL515B_01 tRNA-Cys
  4765. Serratia ficaria tRNA-Cys
  4766. Shigella boydii 3594-74 tRNA-Cys
  4767. Shigella boydii 4444-74 tRNA-Cys
  4768. Shigella boydii 5216-82 tRNA-Cys
  4769. Shigella boydii 965-58 tRNA-Cys
  4770. Shigella boydii CDC 3083-94 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4771. Shigella boydii Sb227 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4772. Shigella boydii tRNA-Cys
  4773. Shigella dysenteriae 1012 tRNA-Cys
  4774. Shigella dysenteriae 155-74 tRNA-Cys
  4775. Shigella dysenteriae 1617 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4776. Shigella dysenteriae 225-75 tRNA-Cys
  4777. Shigella dysenteriae Sd197 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4778. Shigella dysenteriae tRNA-Cys(gca)
  4779. Shigella dysenteriae WRSd3 tRNA-Cys
  4780. Shigella flexneri 1485-80 tRNA-Cys
  4781. Shigella flexneri 1a tRNA-Cys
  4782. Shigella flexneri 1b tRNA-Cys
  4783. Shigella flexneri 1c tRNA-Cys
  4784. Shigella flexneri 2002017 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4785. Shigella flexneri 2003036 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4786. Shigella flexneri 2747-71 tRNA-Cys
  4787. Shigella flexneri 2850-71 tRNA-Cys
  4788. Shigella flexneri 2930-71 tRNA-Cys
  4789. Shigella flexneri 2a str. 2457T tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4790. Shigella flexneri 2a str. 301 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4791. Shigella flexneri 2a tRNA-Cys(gca)
  4792. Shigella flexneri 2b tRNA-Cys(gca)
  4793. Shigella flexneri 3a tRNA-Cys
  4794. Shigella flexneri 3b tRNA-Cys
  4795. Shigella flexneri 4343-70 tRNA-Cys
  4796. Shigella flexneri 4c tRNA-Cys
  4797. Shigella flexneri 5a str. M90T tRNA-Cys
  4798. Shigella flexneri 5b tRNA-Cys
  4799. Shigella flexneri 5 str. 8401 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4800. Shigella flexneri 6603-63 tRNA-Cys
  4801. Shigella flexneri CCH060 tRNA-Cys
  4802. Shigella flexneri G1663 tRNA-Cys
  4803. Shigella flexneri K-1770 tRNA-Cys
  4804. Shigella flexneri K-218 tRNA-Cys
  4805. Shigella flexneri K-227 tRNA-Cys
  4806. Shigella flexneri K-272 tRNA-Cys
  4807. Shigella flexneri K-304 tRNA-Cys
  4808. Shigella flexneri K-315 tRNA-Cys
  4809. Shigella flexneri K-404 tRNA-Cys
  4810. Shigella flexneri K-671 tRNA-Cys
  4811. Shigella flexneri SFJ17B tRNA-Cys
  4812. Shigella flexneri Shi06HN006 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4813. Shigella flexneri tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4814. Shigella flexneri VA-6 tRNA-Cys
  4815. Shigella flexneri X variant tRNA-Cys
  4816. Shigella flexneri Y tRNA-Cys
  4817. Shigella sonnei 3226-85 tRNA-Cys
  4818. Shigella sonnei 3233-85 tRNA-Cys
  4819. Shigella sonnei 4822-66 tRNA-Cys
  4820. Shigella sonnei 53G tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4821. Shigella sonnei Ss046 tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4822. Shigella sonnei str. Moseley tRNA-Cys
  4823. Shigella sonnei tRNA-Cys(gca)
  4824. Shigella sp. CLA-AA-H239 tRNA-Cys
  4825. Shigella sp. tRNA-Cys
  4826. Shigella sp. FC1056 tRNA-Cys
  4827. Shigella sp. FC1139 tRNA-Cys
  4828. Shigella sp. FC1172 tRNA-Cys
  4829. Shigella sp. FC1180 tRNA-Cys
  4830. Shigella sp. FC1544 tRNA-Cys
  4831. Shigella sp. FC1567 tRNA-Cys
  4832. Shigella sp. FC1661 tRNA-Cys
  4833. Shigella sp. FC1708 tRNA-Cys
  4834. Shigella sp. FC1737 tRNA-Cys
  4835. Shigella sp. FC1764 tRNA-Cys
  4836. Shigella sp. FC1882 tRNA-Cys
  4837. Shigella sp. FC2045 tRNA-Cys
  4838. Shigella sp. FC2117 tRNA-Cys
  4839. Shigella sp. FC2125 tRNA-Cys
  4840. Shigella sp. FC2175 tRNA-Cys
  4841. Shigella sp. FC2383 tRNA-Cys
  4842. Shigella sp. FC2531 tRNA-Cys
  4843. Shigella sp. FC2541 tRNA-Cys
  4844. Shigella sp. FC2710 tRNA-Cys
  4845. Shigella sp. FC2833 tRNA-Cys
  4846. Shigella sp. FC2928 tRNA-Cys
  4847. Shigella sp. FC3196 tRNA-Cys
  4848. Shigella sp. FC569 tRNA-Cys
  4849. Shigella sp. PAMC 28760 tRNA-Cys
  4850. Shigella sp. PIB tRNA-Cys
  4851. Streptococcus pneumoniae tRNA-Cys(gca)
  4852. synthetic Escherichia coli C321.deltaA tRNA-Cys (GCA) (tRNA-Cys-GCA-1-1)
  4853. Vibrio sp. 1456-1 tRNA-Cys
2D structure Publications