Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-141-3p URS000003E1A9_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-141: Mmu-mir-141 is a microRNA that has been found to regulate protein expression of PTEN in stromal cells [PMC3692437]. This suggests that mmu-mir-141 plays a role in the regulation of PTEN, a tumor suppressor gene [PMC3692437]. Furthermore, it has been observed that mmu-mir-141 is down-regulated following UVB irradiation [PMC3597329]. This indicates that UVB irradiation may have an impact on the expression of mmu-mir-141 [PMC3597329]. The down-regulation of mmu-mir-141 following UVB irradiation may have implications for the regulation of PTEN protein expression in stromal cells [PMC3597329]. The findings suggest that there is a relationship between mmu-mir-141, PTEN, and UVB irradiation [PMC3692437][PMC3597329]. Understanding the role of mmu-mir-141 in regulating PTEN and its response to UVB irradiation could provide insights into the molecular mechanisms underlying these processes [PMC3692437][PMC3597329]. Further research is needed to fully elucidate the functional significance and potential therapeutic implications of these findings [PMC3692437][PMC3597329].

mRNA interactions 1 total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAACACUGUCUGGUAAAGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Bos taurus (cattle) bta-miR-141
  2. Capra hircus chi-miR-141
  3. Equus caballus (horse) eca-miR-141
  4. Homo sapiens (human) hsa-miR-141-3p
  5. Ovis aries miscellaneous RNA
  6. Pan troglodytes ptr-miR-141
  7. Pteropus alecto (black flying fox) pal-miR-141-3p
  8. Rattus norvegicus rno-miR-141-3p
Publications