Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Burkholderia mallei 5S rRNA secondary structure diagram

Burkholderia mallei 5S rRNA URS000003E12D_13373

Automated summary: This rRNA sequence is 116 nucleotides long and is found in Burkholderia mallei. Annotated by 1 database (5SrRNAdb). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (5S_rRNA, RF00001).

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UGCCUGAUGACCAUAGCGAGUCGGUCCCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCACGCCGAUGAUAGUGCGGAUUGCCCGUGUGAAAGUAGGUAAUCGUCAGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Burkholderia mallei 2002721280 5S ribosomal RNA
    2. Burkholderia mallei ATCC 23344 5S ribosomal RNA
    3. Burkholderia mallei FMH 5S ribosomal RNA
    4. Burkholderia mallei JHU 5S ribosomal RNA
    5. Burkholderia mallei NCTC 10229 5S ribosomal RNA
    6. Burkholderia mallei NCTC 10247 5S ribosomal RNA
    7. Burkholderia mallei SAVP1 5S ribosomal RNA
    8. Burkholderia pseudomallei 1106a 5S ribosomal RNA
    9. Burkholderia pseudomallei 1710b 5S ribosomal RNA
    10. Burkholderia pseudomallei 305 5S ribosomal RNA
    11. Burkholderia pseudomallei 5S rRNA
    12. Burkholderia pseudomallei 668 5S ribosomal RNA
    13. Burkholderia pseudomallei K96243 5S ribosomal RNA
    2D structure