Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Burkholderia mallei 5S rRNA secondary structure diagram

Burkholderia mallei 5S rRNA URS000003E12D_13373

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCCUGAUGACCAUAGCGAGUCGGUCCCACCCCUUCCCAUCCCGAACAGGACCGUGAAACGACUCCACGCCGAUGAUAGUGCGGAUUGCCCGUGUGAAAGUAGGUAAUCGUCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 13 other species

  1. Burkholderia mallei 2002721280 5S ribosomal RNA
  2. Burkholderia mallei ATCC 23344 5S ribosomal RNA
  3. Burkholderia mallei FMH 5S ribosomal RNA
  4. Burkholderia mallei JHU 5S ribosomal RNA
  5. Burkholderia mallei NCTC 10229 5S ribosomal RNA
  6. Burkholderia mallei NCTC 10247 5S ribosomal RNA
  7. Burkholderia mallei SAVP1 5S ribosomal RNA
  8. Burkholderia pseudomallei 1106a 5S ribosomal RNA
  9. Burkholderia pseudomallei 1710b 5S ribosomal RNA
  10. Burkholderia pseudomallei 305 5S ribosomal RNA
  11. Burkholderia pseudomallei 5S rRNA
  12. Burkholderia pseudomallei 668 5S ribosomal RNA
  13. Burkholderia pseudomallei K96243 5S ribosomal RNA
2D structure