Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p URS000003D781_39947

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Oryza sativa Japonica Group. Annotated by 1 database (ENA). Oryza sativa Japonica Group (Japanese rice) microRNA osa-miR408-3p sequence is a product of miR408, osa-miR408, miR408-3p, osa-miR408-3p genes. Found in the japanese rice reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    CUGCACUGCCUCUUCCCUGGC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Brachypodium distachyon (stiff brome) bdi-miR408-3p
    2. Carica papaya (papaya) cpa-miR408
    3. Digitalis purpurea (common foxglove) dpr-miR408
    4. Oryza sativa Indica Group (long-grained rice) miR408
    5. Oryza sativa osa-miR408-3p
    6. Ricinus communis rco-miR408
    7. Saccharum officinarum sof-miR408b
    8. Saccharum sp. ssp-miR408d
    9. Sorghum bicolor sbi-miR408
    10. Triticum aestivum (bread wheat) tae-miR408
    11. Zea mays zma-miR408b-3p