v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Candidatus Sulcia muelleri (insect metagenome) 5S ribosomal RNA secondary structure diagram

Candidatus Sulcia muelleri (insect metagenome) 5S ribosomal RNA URS000003D0D2_336810

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUGGUGAUUAUAGCAACAAGGAUCCACCUCUUUCCAUUCCGAACAGAGAAGUUAAAUUUGUUAGCGCCGAUGGUACUAGUAAUUCUGGAAGAGUAGGUCAUUGCCUAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Candidatus Karelsulcia muelleri GWSS 5S ribosomal RNA
 2D structure