Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lingula anatina Lan-Mir-31-P6_5p (mature (guide)) URS000003AB9C_7574

Automated summary: This miRNA sequence is 23 nucleotides long and is found in Lingula anatina. Annotated by 1 database (MirGeneDB). Found in the Lingula anatina reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AGGCAAGAUGUUGGCAUAGCUGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 73 other species

    1. Anolis carolinensis (green anole) Aca-Mir-31_5p (mature (guide))
    2. Ascaris suum asu-miR-72-5p
    3. Brugia malayi bma-miR-72
    4. Caenorhabditis elegans cel-miR-72-5p
    5. Capitella teleta Cte-Mir-31_5p (mature (guide))
    6. Crassostrea gigas (Pacific oyster) Cgi-Mir-31_5p (mature (guide))
    7. Eisenia fetida Efe-Mir-31_5p (mature (guide))
    8. Euprymna scolopes Esc-Mir-31_5p (mature (guide))
    9. Gallus gallus (chicken) Gallus_gallus piRNA piR-gga-81
    10. Gekko japonicus Gja-Mir-31-P10_5p (mature (guide))
    11. Haemonchus contortus hco-miR-72
    12. Heligmosomoides polygyrus hpo-miR-72-5p
    13. Lottia gigantea (owl limpet) Lgi-Mir-31_5p (mature (guide))
    14. Melibe leonina mle-miR-31-5p
    15. Nautilus pompilius Npo-Mir-31_5p (mature (guide))
    16. Octopus bimaculoides Obi-Mir-31_5p (mature (guide))
    17. Octopus vulgaris (common octopus) Ovu-Mir-31_5p (mature (guide))
    18. Python bivittatus (Burmese python) Pbv-Mir-31_5p (mature (guide))
    19. Strongyloides ratti str-miR-72-5p