v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Callorhinchus milii (elephant shark) eshark_mir-8_3 URS000003AB8C_7868

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAAUACUGUCUGGUAAUGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Capra hircus (goat) chi-miR-429
  2. Cervus elaphus (red deer) Cel-miR-429
  3. Equus caballus (horse) eca-miR-429
  4. Ictalurus punctatus (channel catfish) ipu-miR-429a
  5. Mus musculus Mus_musculus piRNA piR-mmu-72580
  6. Salmo salar ssa-miR-429-3p
  7. Xenopus laevis (African clawed frog) xla-miR-429
  8. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-4827576