Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Equus caballus (horse) eca-miR-872 URS00000386E7_9796

Automated summary: This miRNA sequence is 21 nucleotides long and is found in Equus caballus. Annotated by 2 databases (miRBase, RefSeq). Described in 3 papers. Equus caballus (horse) eca-miR-872 sequence is a product of MIR872, miR-872, eca-miR-872 genes. Found in the horse reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AAGGUUACUUGUUAGUUCAGG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 11 other species

    1. Cavia porcellus cpo-miR-872-5p
    2. Cricetulus griseus cgr-miR-872-5p
    3. Microcebus murinus mmr-miR-872
    4. Mus musculus mmu-miR-872-5p
    5. Oryctolagus cuniculus ocu-miR-872-5p
    6. Rattus norvegicus rno-miR-872-5p